AOC3 Rabbit Polyclonal Antibody

AOC3 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

AOC3 Polyclonal Antibody

ES11338-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AOC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AOC3 Rabbit pAb

A2001-100ul 100 ul
EUR 308

AOC3 Rabbit pAb

A2001-200ul 200 ul
EUR 459

AOC3 Rabbit pAb

A2001-20ul 20 ul
EUR 183

AOC3 Rabbit pAb

A2001-50ul 50 ul
EUR 223

Polyclonal AOC3 Antibody (Center)

APR11425G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AOC3 (Center). This antibody is tested and proven to work in the following applications:

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Hu-48T 48T
EUR 517
  • Should the Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Hu-96T 96T
EUR 673
  • Should the Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Mu-48T 48T
EUR 527
  • Should the Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Mu-96T 96T
EUR 688
  • Should the Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Ra-48T 48T
EUR 549
  • Should the Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Ra-96T 96T
EUR 718
  • Should the Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Hu-48Tests 48 Tests
EUR 544

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Hu-96Tests 96 Tests
EUR 756

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Mu-48Tests 48 Tests
EUR 557

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Mu-96Tests 96 Tests
EUR 774

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Ra-48Tests 48 Tests
EUR 583

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Ra-96Tests 96 Tests
EUR 811

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Hu-48Tests 48 Tests
EUR 521

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Hu-96Tests 96 Tests
EUR 723

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Mu-48Tests 48 Tests
EUR 533

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Mu-96Tests 96 Tests
EUR 740

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Ra-48Tests 48 Tests
EUR 557

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Ra-96Tests 96 Tests
EUR 775

AOC3 antibody

70R-15743 50 ul
EUR 435
Description: Rabbit polyclonal AOC3 antibody

AOC3 Antibody

32546-100ul 100ul
EUR 252

AOC3 Antibody

43880-100ul 100ul
EUR 252

AOC3 Antibody

1-CSB-PA001855GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

AOC3 Antibody

1-CSB-PA624122LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AOC3 Antibody

DF6745 200ul
EUR 304
Description: AOC3 Antibody detects endogenous levels of total AOC3.

AOC3 Antibody

ABD6745 100 ug
EUR 438

Polyclonal Goat Anti-AOC3 Antibody

APR12069G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AOC3 . This antibody is tested and proven to work in the following applications:

Polyclonal AOC3 / VAP-1 Antibody (Internal)

AMRa00049G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AOC3 / VAP-1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal AOC3 / VAP1 Antibody (internal region)

APR11424G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AOC3 / VAP1 (internal region). This antibody is tested and proven to work in the following applications:

AOC3 Conjugated Antibody

C43880 100ul
EUR 397

AOC3 Conjugated Antibody

C32546 100ul
EUR 397

Anti-AOC3 antibody

STJ22624 100 µl
EUR 277
Description: This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants.

Anti-AOC3 antibody

STJ71075 100 µg
EUR 359

Anti-AOC3 antibody

STJ192496 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AOC3

Aoc3/ Rat Aoc3 ELISA Kit

ELI-03530r 96 Tests
EUR 886

AOC3 siRNA

20-abx900345
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AOC3 siRNA

20-abx907688
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AOC3 siRNA

20-abx907689
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AOC3 Antibody, HRP conjugated

1-CSB-PA624122LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AOC3 Antibody, FITC conjugated

1-CSB-PA624122LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AOC3 Antibody, Biotin conjugated

1-CSB-PA624122LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-AOC3 / VAP1 antibody

STJ72165 100 µg
EUR 359

AOC3 Blocking Peptide

DF6745-BP 1mg
EUR 195

AOC3 cloning plasmid

CSB-CL624122HU-10ug 10ug
EUR 751
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2292
  • Sequence: atgaaccagaagacaatcctcgtgctcctcattctggccgtcatcaccatctttgccttggtttgtgtcctgctggtgggcaggggtggagatgggggtgaacccagccagcttccccattgcccctctgtatctcccagtgcccagccttggacacaccctggccagagccagc
  • Show more
Description: A cloning plasmid for the AOC3 gene.

Membrane Primary Amine Oxidase (AOC3) Antibody

20-abx110946
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody

abx033988-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody

abx033988-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody

20-abx333876
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody

20-abx001627
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human AOC3 ELISA Kit

ELA-E1083h 96 Tests
EUR 824

AOC3 ELISA KIT|Human

EF009118 96 Tests
EUR 689

Rat AOC3 shRNA Plasmid

20-abx985523
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AOC3 shRNA Plasmid

20-abx955678
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AOC3 shRNA Plasmid

20-abx969153
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AOC3 Recombinant Protein (Human)

RP001399 100 ug Ask for price

AOC3 Recombinant Protein (Mouse)

RP116186 100 ug Ask for price

AOC3 Recombinant Protein (Rat)

RP190385 100 ug Ask for price

Amine Oxidase, Copper Containing 3 (AOC3) Antibody

20-abx175354
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Amine Oxidase, Copper Containing 3 (AOC3) Antibody

20-abx175355
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Membrane Primary Amine Oxidase (AOC3) Antibody (HRP)

20-abx336489
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody (FITC)

20-abx336490
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody (Biotin)

20-abx336491
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Amine Oxidase, Copper Containing 3 (AOC3) Antibody

abx430190-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Amine Oxidase, Copper Containing 3 (AOC3) Antibody

abx431095-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Aoc3 ORF Vector (Rat) (pORF)

ORF063463 1.0 ug DNA
EUR 506

AOC3 ORF Vector (Human) (pORF)

ORF000467 1.0 ug DNA
EUR 95

Aoc3 ORF Vector (Mouse) (pORF)

ORF038730 1.0 ug DNA
EUR 506

AOC3 ELISA Kit (Mouse) (OKAN05141)

OKAN05141 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.65 ng/mL

AOC3 ELISA Kit (Human) (OKBB01153)

OKBB01153 96 Wells
EUR 505
Description: Description of target: Amine oxidase, copper containing 3, also known as vascular adhesion protein (VAP-1) and HPAO is an enzyme that in humans is encoded by the AOC3 gene on chromosome 17. This protein is a member of the semicarbazide-sensitive amine oxidase (SSAO) family and is associated with many vascular diseases. This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <20pg/ml

AOC3 ELISA Kit (Mouse) (OKCD08074)

OKCD08074 96 Wells
EUR 1001
Description: Description of target: Cell adhesion protein that participates in lymphocyte recirculation by mediating the binding of lymphocytes to peripheral lymph node vascular endothelial cells in an L-selectin-independent fashion. Has a monoamine oxidase activity. May play a role in adipogenesis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.65ng/mL

AOC3 ELISA Kit (Mouse) (OKEH03283)

OKEH03283 96 Wells
EUR 662
Description: Description of target: Cell adhesion protein that participates in lymphocyte recirculation by mediating the binding of lymphocytes to peripheral lymph node vascular endothelial cells in an L-selectin-independent fashion. Has a monoamine oxidase activity. May play a role in adipogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

AOC3 ELISA Kit (Rat) (OKEH03284)

OKEH03284 96 Wells
EUR 662
Description: Description of target: Cell adhesion protein that participates in lymphocyte recirculation by mediating the binding of lymphocytes to peripheral lymph node vascular endothelial cells in an L-selectin-independent fashion. Has a monoamine oxidase activity. May play a role in adipogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.402 ng/mL

Anti-AOC3 (Vapaliximab)-SPDB-DM4 ADC

ADC-W-669 1mg Ask for price
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a SPDB linker to DM4

Anti-AOC3 (Vapaliximab)-MC-MMAF ADC

ADC-W-670 1mg Ask for price
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a MC linker to MMAF

Anti-AOC3 (Vepalimomab)-SMCC-DM1 ADC

ADC-W-674 1mg Ask for price
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a SMCC linker to DM1

Anti-AOC3 (Vepalimomab)-SPDB-DM4 ADC

ADC-W-675 1mg Ask for price
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a SPDB linker to DM4

Anti-AOC3 (Vepalimomab)-MC-MMAF ADC

ADC-W-676 1mg Ask for price
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a MC linker to MMAF

Aoc3 sgRNA CRISPR Lentivector set (Rat)

K6774801 3 x 1.0 ug
EUR 339

Aoc3 sgRNA CRISPR Lentivector set (Mouse)

K4574201 3 x 1.0 ug
EUR 339

AOC3 sgRNA CRISPR Lentivector set (Human)

K0099001 3 x 1.0 ug
EUR 339

Human VAP-1/AOC3 PicoKine ELISA Kit

EK1646 96 wells
EUR 425
Description: For Quantitative Detection of human VAP-1 in cell culture supernates, serum and plasma (heparin, EDTA).

Anti-AOC3 (Vapaliximab) (Vapaliximab)-SMCC-DM1 ADC

ADC-W-668 1mg Ask for price
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a SMCC linker to DM1

Aoc3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6774802 1.0 ug DNA
EUR 154

Aoc3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6774803 1.0 ug DNA
EUR 154

Aoc3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6774804 1.0 ug DNA
EUR 154

Aoc3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4574202 1.0 ug DNA
EUR 154

Aoc3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4574203 1.0 ug DNA
EUR 154

Aoc3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4574204 1.0 ug DNA
EUR 154

AOC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0099002 1.0 ug DNA
EUR 154

AOC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0099003 1.0 ug DNA
EUR 154

AOC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0099004 1.0 ug DNA
EUR 154

AOC3 Protein Vector (Mouse) (pPB-C-His)

PV154918 500 ng
EUR 1065

AOC3 Protein Vector (Mouse) (pPB-N-His)

PV154919 500 ng
EUR 1065

AOC3 Protein Vector (Mouse) (pPM-C-HA)

PV154920 500 ng
EUR 1065

AOC3 Protein Vector (Mouse) (pPM-C-His)

PV154921 500 ng
EUR 1065

AOC3 Protein Vector (Rat) (pPB-C-His)

PV253850 500 ng
EUR 1166

AOC3 Protein Vector (Rat) (pPB-N-His)

PV253851 500 ng
EUR 1166

AOC3 Protein Vector (Rat) (pPM-C-HA)

PV253852 500 ng
EUR 1166

AOC3 Protein Vector (Rat) (pPM-C-His)

PV253853 500 ng
EUR 1166

AOC3 Protein Vector (Human) (pPB-His-MBP)

PV322478 500 ng
EUR 329

AOC3 Protein Vector (Human) (pPB-His-GST)

PV322479 500 ng
EUR 329

AOC3 Protein Vector (Human) (pPB-C-His)

PV001865 500 ng
EUR 329

AOC3 Protein Vector (Human) (pPB-N-His)

PV001866 500 ng
EUR 329

AOC3 Protein Vector (Human) (pPM-C-HA)

PV001867 500 ng
EUR 329

AOC3 Protein Vector (Human) (pPM-C-His)

PV001868 500 ng
EUR 329

Aoc3 3'UTR GFP Stable Cell Line

TU151895 1.0 ml Ask for price

Aoc3 3'UTR Luciferase Stable Cell Line

TU101895 1.0 ml Ask for price

Aoc3 3'UTR Luciferase Stable Cell Line

TU200705 1.0 ml Ask for price

Aoc3 3'UTR GFP Stable Cell Line

TU250705 1.0 ml Ask for price

AOC3 3'UTR GFP Stable Cell Line

TU050896 1.0 ml
EUR 1521

AOC3 3'UTR Luciferase Stable Cell Line

TU000896 1.0 ml
EUR 1521

AOC3 ELISA Kit (Human) : 96 Wells (OKEH00749)

OKEH00749 96 Wells
EUR 544
Description: Description of target: This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

AOC3 Rabbit Polyclonal Antibody