SPAG8 Rabbit Polyclonal Antibody
SPAG8 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
 SPAG8 Polyclonal Antibody |
|
ABP60486-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein |
SPAG8 Polyclonal Antibody |
|
ABP60486-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein |
SPAG8 Polyclonal Antibody |
|
ES11041-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against SPAG8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SPAG8 Polyclonal Antibody |
|
ES11041-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against SPAG8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 SPAG8 Rabbit pAb |
|
A8943-100ul |
Abclonal |
100 ul |
EUR 308 |
SPAG8 Rabbit pAb |
|
A8943-200ul |
Abclonal |
200 ul |
EUR 459 |
SPAG8 Rabbit pAb |
|
A8943-20ul |
Abclonal |
20 ul |
EUR 183 |
SPAG8 Rabbit pAb |
|
A8943-50ul |
Abclonal |
50 ul |
EUR 223 |
 SPAG8 antibody |
|
70R-20476 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal SPAG8 antibody |
SPAG8 antibody |
|
70R-2385 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal SPAG8 antibody raised against the N terminal of SPAG8 |
SPAG8 antibody |
|
70R-2386 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal SPAG8 antibody raised against the middle region of SPAG8 |
 SPAG8 Antibody |
|
35927-100ul |
SAB |
100ul |
EUR 252 |
SPAG8 Antibody |
|
1-CSB-PA858730LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
SPAG8 Antibody |
|
1-CSB-PA269500 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
SPAG8 Antibody |
|
1-CSB-PA209919 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
SPAG8 Antibody |
|
1-CSB-PA022469GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
 SPAG8 Polyclonal Antibody, HRP Conjugated |
|
A69156 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: kits suitable for this type of research |
 SPAG8 Polyclonal Antibody, FITC Conjugated |
|
A69157 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: fast delivery possible |
 SPAG8 Polyclonal Antibody, Biotin Conjugated |
|
A69158 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: reagents widely cited |
 SPAG8 Conjugated Antibody |
|
C35927 |
SAB |
100ul |
EUR 397 |
 anti- SPAG8 antibody |
|
FNab08146 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: sperm associated antigen 8
- Uniprot ID: Q99932
- Gene ID: 26206
- Research Area: Stem Cells
|
|
Description: Antibody raised against SPAG8 |
 Anti-SPAG8 antibody |
|
STJ113600 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. |
Anti-SPAG8 antibody |
|
STJ192199 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SPAG8 |
 SPAG8 siRNA |
|
20-abx934799 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-SPAG8 |
|
YF-PA18238 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to SPAG8 |
anti-SPAG8 |
|
YF-PA18239 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to SPAG8 |
 SPAG8 Antibody, HRP conjugated |
|
1-CSB-PA858730LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 SPAG8 Antibody, FITC conjugated |
|
1-CSB-PA858730LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 SPAG8 Antibody, Biotin conjugated |
|
1-CSB-PA858730LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 SPAG8 Blocking Peptide |
|
33R-8479 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2385 |
SPAG8 Blocking Peptide |
|
33R-6974 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2386 |
 SPAG8 cloning plasmid |
|
CSB-CL858730HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1506
- Sequence: atggagaccaacgggtctacggagggatcgcggtcgcggtcgcgatctttagacatacagcccagctccgaaggactggggcccacttcggaaccgtttccttcttcagatgacagtcccaggtcggccctggcagctgcaaccgcagcagctgcagcggctgcatcagctgctg
- Show more
|
|
Description: A cloning plasmid for the SPAG8 gene. |
) Anti-SPAG8 (2F12) |
|
YF-MA18062 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SPAG8 |
 Human SPAG8 shRNA Plasmid |
|
20-abx958755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SPAG8 Recombinant Protein (Rat) |
|
RP230627 |
ABM |
100 ug |
Ask for price |
) SPAG8 Recombinant Protein (Human) |
|
RP029767 |
ABM |
100 ug |
Ask for price |
) SPAG8 Recombinant Protein (Mouse) |
|
RP174728 |
ABM |
100 ug |
Ask for price |
 Antibody) Sperm Associated Antigen 8 (SPAG8) Antibody |
|
20-abx115763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Sperm-Associated Antigen 8 (SPAG8) Antibody |
|
abx122908-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
|
20-abx124599 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
|
abx238146-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
|
20-abx339750 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
|
20-abx339751 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
|
20-abx333753 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Sperm-Associated Antigen 8 (SPAG8) Antibody (HRP) |
|
20-abx337781 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Sperm-Associated Antigen 8 (SPAG8) Antibody (FITC) |
|
20-abx337782 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Sperm-Associated Antigen 8 (SPAG8) Antibody (Biotin) |
|
20-abx337783 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Spag8 ORF Vector (Rat) (pORF) |
|
ORF076877 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SPAG8 ORF Vector (Human) (pORF) |
|
ORF009923 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Spag8 ORF Vector (Mouse) (pORF) |
|
ORF058244 |
ABM |
1.0 ug DNA |
EUR 506 |
) Spag8 sgRNA CRISPR Lentivector set (Rat) |
|
K6142601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Spag8 sgRNA CRISPR Lentivector set (Mouse) |
|
K3028801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) SPAG8 sgRNA CRISPR Lentivector set (Human) |
|
K2264601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Spag8 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6142602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Spag8 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6142603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Spag8 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6142604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3028802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3028803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3028804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) SPAG8 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2264602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SPAG8 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2264603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SPAG8 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2264604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SPAG8 Protein Vector (Rat) (pPB-C-His) |
|
PV307506 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SPAG8 Protein Vector (Rat) (pPB-N-His) |
|
PV307507 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SPAG8 Protein Vector (Rat) (pPM-C-HA) |
|
PV307508 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SPAG8 Protein Vector (Rat) (pPM-C-His) |
|
PV307509 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SPAG8 Protein Vector (Human) (pPB-C-His) |
|
PV039689 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SPAG8 Protein Vector (Human) (pPB-N-His) |
|
PV039690 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SPAG8 Protein Vector (Human) (pPM-C-HA) |
|
PV039691 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SPAG8 Protein Vector (Human) (pPM-C-His) |
|
PV039692 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) SPAG8 Protein Vector (Mouse) (pPB-C-His) |
|
PV232974 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SPAG8 Protein Vector (Mouse) (pPB-N-His) |
|
PV232975 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SPAG8 Protein Vector (Mouse) (pPM-C-HA) |
|
PV232976 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SPAG8 Protein Vector (Mouse) (pPM-C-His) |
|
PV232977 |
ABM |
500 ng |
EUR 603 |
 Spag8 3'UTR Luciferase Stable Cell Line |
|
TU119522 |
ABM |
1.0 ml |
Ask for price |
 Spag8 3'UTR GFP Stable Cell Line |
|
TU169522 |
ABM |
1.0 ml |
Ask for price |
Spag8 3'UTR Luciferase Stable Cell Line |
|
TU221024 |
ABM |
1.0 ml |
Ask for price |
Spag8 3'UTR GFP Stable Cell Line |
|
TU271024 |
ABM |
1.0 ml |
Ask for price |
 SPAG8 3'UTR GFP Stable Cell Line |
|
TU074378 |
ABM |
1.0 ml |
EUR 1521 |
 SPAG8 3'UTR Luciferase Stable Cell Line |
|
TU024378 |
ABM |
1.0 ml |
EUR 1521 |
 Human Sperm- associated antigen 8, SPAG8 ELISA KIT |
|
ELI-29622h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit) Human Sperm-Associated Antigen 8 (SPAG8) ELISA Kit |
|
abx383397-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
SPAG8 Rabbit Polyclonal Antibody
