SPAG8 Rabbit Polyclonal Antibody

SPAG8 Rabbit Polyclonal Antibody

To Order Now:

SPAG8 Polyclonal Antibody

ABP60486-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein

SPAG8 Polyclonal Antibody

ABP60486-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein

SPAG8 Polyclonal Antibody

ABP60486-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein

SPAG8 Polyclonal Antibody

A69155 100 ?g
EUR 628.55
Description: The best epigenetics products

SPAG8 Rabbit pAb

A8943-100ul 100 ul
EUR 308

SPAG8 Rabbit pAb

A8943-200ul 200 ul
EUR 459

SPAG8 Rabbit pAb

A8943-20ul 20 ul
EUR 183

SPAG8 Rabbit pAb

A8943-50ul 50 ul
EUR 223

SPAG8 antibody

70R-2385 50 ug
EUR 467
Description: Rabbit polyclonal SPAG8 antibody raised against the N terminal of SPAG8

SPAG8 antibody

70R-2386 50 ug
EUR 467
Description: Rabbit polyclonal SPAG8 antibody raised against the middle region of SPAG8

SPAG8 Antibody

35927-100ul 100ul
EUR 252

SPAG8 antibody

70R-20476 50 ul
EUR 435
Description: Rabbit polyclonal SPAG8 antibody

SPAG8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

SPAG8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

SPAG8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

SPAG8 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SPAG8 Polyclonal Antibody, HRP Conjugated

A69156 100 ?g
EUR 628.55
Description: kits suitable for this type of research

SPAG8 Polyclonal Antibody, FITC Conjugated

A69157 100 ?g
EUR 628.55
Description: fast delivery possible

SPAG8 Polyclonal Antibody, Biotin Conjugated

A69158 100 ?g
EUR 628.55
Description: reagents widely cited

SPAG8 Conjugated Antibody

C35927 100ul
EUR 397

anti- SPAG8 antibody

FNab08146 100µg
EUR 548.75
  • Immunogen: sperm associated antigen 8
  • Uniprot ID: Q99932
  • Gene ID: 26206
  • Research Area: Stem Cells
Description: Antibody raised against SPAG8

Anti-SPAG8 antibody

PAab08146 100 ug
EUR 386

Anti-SPAG8 antibody

STJ113600 100 µl
EUR 277
Description: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined.

Anti-SPAG8 antibody

STJ192199 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPAG8


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17301 2 ug
EUR 231


YF-PA18238 50 ul
EUR 363
Description: Mouse polyclonal to SPAG8


YF-PA18239 50 ug
EUR 363
Description: Mouse polyclonal to SPAG8

SPAG8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPAG8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SPAG8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SPAG8 Blocking Peptide

33R-6974 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2386

SPAG8 Blocking Peptide

33R-8479 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2385

SPAG8 cloning plasmid

CSB-CL858730HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggagaccaacgggtctacggagggatcgcggtcgcggtcgcgatctttagacatacagcccagctccgaaggactggggcccacttcggaaccgtttccttcttcagatgacagtcccaggtcggccctggcagctgcaaccgcagcagctgcagcggctgcatcagctgctg
  • Show more
Description: A cloning plasmid for the SPAG8 gene.

Anti-SPAG8 (2F12)

YF-MA18062 100 ug
EUR 363
Description: Mouse monoclonal to SPAG8


EF003162 96 Tests
EUR 689

Human SPAG8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SPAG8 Recombinant Protein (Human)

RP029767 100 ug Ask for price

SPAG8 Recombinant Protein (Rat)

RP230627 100 ug Ask for price

SPAG8 Recombinant Protein (Mouse)

RP174728 100 ug Ask for price

Sperm-Associated Antigen 8 (SPAG8) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm Associated Antigen 8 (SPAG8) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

abx122908-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

abx238146-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Spag8 ORF Vector (Mouse) (pORF)

ORF058244 1.0 ug DNA
EUR 506

SPAG8 ORF Vector (Human) (pORF)

ORF009923 1.0 ug DNA
EUR 95

Spag8 ORF Vector (Rat) (pORF)

ORF076877 1.0 ug DNA
EUR 506

SPAG8 sgRNA CRISPR Lentivector set (Human)

K2264601 3 x 1.0 ug
EUR 339

Spag8 sgRNA CRISPR Lentivector set (Rat)

K6142601 3 x 1.0 ug
EUR 339

Spag8 sgRNA CRISPR Lentivector set (Mouse)

K3028801 3 x 1.0 ug
EUR 339

SPAG8 sgRNA CRISPR Lentivector (Human) (Target 1)

K2264602 1.0 ug DNA
EUR 154

SPAG8 sgRNA CRISPR Lentivector (Human) (Target 2)

K2264603 1.0 ug DNA
EUR 154

SPAG8 sgRNA CRISPR Lentivector (Human) (Target 3)

K2264604 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6142602 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6142603 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6142604 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3028802 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3028803 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3028804 1.0 ug DNA
EUR 154

SPAG8 Protein Vector (Human) (pPB-C-His)

PV039689 500 ng
EUR 329

SPAG8 Protein Vector (Human) (pPB-N-His)

PV039690 500 ng
EUR 329

SPAG8 Protein Vector (Human) (pPM-C-HA)

PV039691 500 ng
EUR 329

SPAG8 Protein Vector (Human) (pPM-C-His)

PV039692 500 ng
EUR 329

SPAG8 Protein Vector (Rat) (pPB-C-His)

PV307506 500 ng
EUR 603

SPAG8 Protein Vector (Rat) (pPB-N-His)

PV307507 500 ng
EUR 603

SPAG8 Protein Vector (Rat) (pPM-C-HA)

PV307508 500 ng
EUR 603

SPAG8 Protein Vector (Rat) (pPM-C-His)

PV307509 500 ng
EUR 603

SPAG8 Protein Vector (Mouse) (pPB-C-His)

PV232974 500 ng
EUR 603

SPAG8 Protein Vector (Mouse) (pPB-N-His)

PV232975 500 ng
EUR 603

SPAG8 Protein Vector (Mouse) (pPM-C-HA)

PV232976 500 ng
EUR 603

SPAG8 Protein Vector (Mouse) (pPM-C-His)

PV232977 500 ng
EUR 603

Spag8 3'UTR GFP Stable Cell Line

TU169522 1.0 ml Ask for price

Spag8 3'UTR Luciferase Stable Cell Line

TU119522 1.0 ml Ask for price

SPAG8 3'UTR GFP Stable Cell Line

TU074378 1.0 ml
EUR 1521

SPAG8 3'UTR Luciferase Stable Cell Line

TU024378 1.0 ml
EUR 1521

Spag8 3'UTR Luciferase Stable Cell Line

TU221024 1.0 ml Ask for price

Spag8 3'UTR GFP Stable Cell Line

TU271024 1.0 ml Ask for price

Human Sperm- associated antigen 8, SPAG8 ELISA KIT

ELI-29622h 96 Tests
EUR 824

Human Sperm-Associated Antigen 8 (SPAG8) ELISA Kit

abx383397-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SPAG8 Rabbit Polyclonal Antibody