PGS1 Rabbit Polyclonal Antibody

PGS1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PGS1 Polyclonal Antibody
ES11314-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PGS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PGS1 Polyclonal Antibody
ABP59893-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of PGS1 from Human, Mouse, Rat. This PGS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
PGS1 Polyclonal Antibody
ABP59893-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of PGS1 from Human, Mouse, Rat. This PGS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
PGS1 Polyclonal Antibody
ABP59893-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of PGS1 from Human, Mouse, Rat. This PGS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
PGS1 Polyclonal Antibody
A64890 100 µg
EUR 570.55
Description: Ask the seller for details
PGS1 Polyclonal Antibody
28496-100ul 100ul
EUR 252
PGS1 Polyclonal Antibody
28496-50ul 50ul
EUR 187
PGS1 Rabbit pAb
A4309-100ul 100 ul
EUR 308
PGS1 Rabbit pAb
A4309-200ul 200 ul
EUR 459
PGS1 Rabbit pAb
A4309-20ul 20 ul Ask for price
PGS1 Rabbit pAb
A4309-50ul 50 ul Ask for price
PGS1 Rabbit pAb
A14308-100ul 100 ul
EUR 308
PGS1 Rabbit pAb
A14308-200ul 200 ul
EUR 459
PGS1 Rabbit pAb
A14308-20ul 20 ul
EUR 183
PGS1 Rabbit pAb
A14308-50ul 50 ul
EUR 223
Polyclonal PGS1 Antibody (Center)
APR09102G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PGS1 (Center). This antibody is tested and proven to work in the following applications:
PGS1 Polyclonal Conjugated Antibody
C28496 100ul
EUR 397
PGS1 antibody
70R-5274 50 ug
EUR 467
Description: Rabbit polyclonal PGS1 antibody raised against the C terminal of PGS1
PGS1 antibody
70R-19249 50 ul
EUR 435
Description: Rabbit polyclonal PGS1 antibody
PGS1 antibody
70R-1011 100 ug
EUR 377
Description: Rabbit polyclonal PGS1 antibody raised against the C terminal of PGS1
PGS1 Antibody
1-CSB-PA653479LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
PGS1 Antibody
1-CSB-PA017878GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
PGS1 Polyclonal Antibody, HRP Conjugated
A64891 100 µg
EUR 570.55
Description: The best epigenetics products
PGS1 Polyclonal Antibody, FITC Conjugated
A64892 100 µg
EUR 570.55
Description: kits suitable for this type of research
PGS1 Polyclonal Antibody, Biotin Conjugated
A64893 100 µg
EUR 570.55
Description: fast delivery possible
anti- PGS1 antibody
FNab06367 100µg
EUR 548.75
  • Immunogen: phosphatidylglycerophosphate synthase 1
  • Uniprot ID: Q32NB8
  • Gene ID: 9489
  • Research Area: Metabolism
Description: Antibody raised against PGS1
Anti-PGS1 antibody
PAab06367 100 ug
EUR 386
Anti-PGS1 antibody
STJ26613 100 µl
EUR 277
Anti-PGS1 antibody
STJ116520 100 µl
EUR 277
Anti-PGS1 antibody
STJ192472 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PGS1
PGS1 siRNA
20-abx928400
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PGS1 siRNA
20-abx928401
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PGS1
YF-PA16343 50 ug
EUR 363
Description: Mouse polyclonal to PGS1
PGS1 Antibody, HRP conjugated
1-CSB-PA653479LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PGS1 Antibody, FITC conjugated
1-CSB-PA653479LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PGS1 Antibody, Biotin conjugated
1-CSB-PA653479LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PGS1 Blocking Peptide
33R-7584 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGS1 antibody, catalog no. 70R-5274
PGS1 Blocking Peptide
33R-8255 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGS1 antibody, catalog no. 70R-1011
PGS1 cloning plasmid
CSB-CL653479HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgaaggggcagataagagtagccaagaggcgggtcgtgatggcatccctctacctggggacaggtcctttggaacaggagctggtggactgcctggaaagtactctagaaaagtcactccaagcaaagtttccttcaaatctcaaggtctccattctcttagacttcacgcggg
  • Show more
Description: A cloning plasmid for the PGS1 gene.
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody
20-abx003202
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody
abx029732-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody
abx029732-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody
20-abx318570
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody
abx236367-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (HRP)
20-abx307175
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (FITC)
20-abx307176
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (Biotin)
20-abx307177
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse PGS1 shRNA Plasmid
20-abx978234
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PGS1 ELISA Kit
ELA-E10812h 96 Tests
EUR 824
Bovine PGS1 ELISA KIT
ELI-12658b 96 Tests
EUR 928
Human PGS1 ELISA KIT
ELI-21973h 96 Tests
EUR 824
PGS1 ELISA KIT|Human
EF002807 96 Tests
EUR 689
Mouse Pgs1 ELISA KIT
ELI-36283m 96 Tests
EUR 865
Chicken PGS1 ELISA KIT
ELI-45023c 96 Tests
EUR 928
Human PGS1 shRNA Plasmid
20-abx956301
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PGS1 Recombinant Protein (Human)
RP023263 100 ug Ask for price
PGS1 Recombinant Protein (Mouse)
RP161639 100 ug Ask for price
PGS1 ORF Vector (Human) (pORF)
ORF007755 1.0 ug DNA
EUR 95
Pgs1 ORF Vector (Mouse) (pORF)
ORF053881 1.0 ug DNA
EUR 506
pSV40- Pgs1- m (824- 1662bp)
PVT11454 2 ug
EUR 273
PGS1 ELISA Kit (Human) (OKEH02115)
OKEH02115 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.17 ng/mL
PGS1 ELISA Kit (Mouse) (OKEH05704)
OKEH05704 96 Wells
EUR 779
Description: Description of target: Functions in the biosynthesis of the anionic phospholipids phosphatidylglycerol and cardiolipin.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.157 ng/mL
PGS1 ELISA Kit (Bovine) (OKEH07656)
OKEH07656 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
PGS1 ELISA Kit (Chicken) (OKEH07657)
OKEH07657 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.44ng/mL
PGS1 sgRNA CRISPR Lentivector set (Human)
K1636901 3 x 1.0 ug
EUR 339
Pgs1 sgRNA CRISPR Lentivector set (Mouse)
K4522801 3 x 1.0 ug
EUR 339
Rabbit CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, mitochondrial(PGS1) ELISA kit
E04C2380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, mitochondrial(PGS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, mitochondrial(PGS1) ELISA kit
E04C2380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, mitochondrial(PGS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, mitochondrial(PGS1) ELISA kit
E04C2380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, mitochondrial(PGS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CDP diacylglycerol glycerol 3 phosphate 3 phosphatidyltransferase, mitochondrial(PGS1) ELISA kit
E04C0914-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CDP diacylglycerol glycerol 3 phosphate 3 phosphatidyltransferase, mitochondrial(PGS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CDP diacylglycerol glycerol 3 phosphate 3 phosphatidyltransferase, mitochondrial(PGS1) ELISA kit
E04C0914-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CDP diacylglycerol glycerol 3 phosphate 3 phosphatidyltransferase, mitochondrial(PGS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CDP diacylglycerol glycerol 3 phosphate 3 phosphatidyltransferase, mitochondrial(PGS1) ELISA kit
E04C0914-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CDP diacylglycerol glycerol 3 phosphate 3 phosphatidyltransferase, mitochondrial(PGS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Cow Phosphatidylglycerophosphate Synthase 1 (PGS1) ELISA Kit
abx515081-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Phosphatidylglycerophosphate Synthase 1 (PGS1) ELISA Kit
abx515082-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Phosphatidylglycerophosphate Synthase 1 (PGS1) ELISA Kit
abx515083-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Phosphatidylglycerophosphate Synthase 1 (PGS1) ELISA Kit
abx515084-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
PGS1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1636902 1.0 ug DNA
EUR 154
PGS1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1636903 1.0 ug DNA
EUR 154
PGS1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1636904 1.0 ug DNA
EUR 154
Pgs1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4522802 1.0 ug DNA
EUR 154
Pgs1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4522803 1.0 ug DNA
EUR 154
Pgs1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4522804 1.0 ug DNA
EUR 154
Human Phosphatidylglycerophosphate Synthase 1(PGS1)ELISA Kit
QY-E02280 96T
EUR 361
PGS1 Protein Vector (Human) (pPB-C-His)
PV031017 500 ng
EUR 329
PGS1 Protein Vector (Human) (pPB-N-His)
PV031018 500 ng
EUR 329
PGS1 Protein Vector (Human) (pPM-C-HA)
PV031019 500 ng
EUR 329
PGS1 Protein Vector (Human) (pPM-C-His)
PV031020 500 ng
EUR 329
PGS1 Protein Vector (Mouse) (pPB-C-His)
PV215522 500 ng
EUR 603
PGS1 Protein Vector (Mouse) (pPB-N-His)
PV215523 500 ng
EUR 603
PGS1 Protein Vector (Mouse) (pPM-C-HA)
PV215524 500 ng
EUR 603
PGS1 Protein Vector (Mouse) (pPM-C-His)
PV215525 500 ng
EUR 603
Pgs1 3'UTR GFP Stable Cell Line
TU166269 1.0 ml Ask for price
PGS1 3'UTR Luciferase Stable Cell Line
TU017826 1.0 ml
EUR 1394
Pgs1 3'UTR Luciferase Stable Cell Line
TU116269 1.0 ml Ask for price
PGS1 3'UTR GFP Stable Cell Line
TU067826 1.0 ml
EUR 1394
Pgs1 3'UTR GFP Stable Cell Line
TU266150 1.0 ml Ask for price
Pgs1 3'UTR Luciferase Stable Cell Line
TU216150 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

PGS1 Rabbit Polyclonal Antibody