RSPO3 Rabbit Polyclonal Antibody

RSPO3 Rabbit Polyclonal Antibody

To Order Now:

RSPO3 Polyclonal Antibody
ES11202-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RSPO3 Polyclonal Antibody
ES11202-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RSPO3 Polyclonal Antibody
ABP60272-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein
RSPO3 Polyclonal Antibody
ABP60272-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein
RSPO3 Polyclonal Antibody
ABP60272-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein
RSPO3 Polyclonal Antibody
A60722 100 µg
EUR 570.55
Description: The best epigenetics products
RSPO3 Polyclonal Antibody
A67930 100 µg
EUR 570.55
Description: kits suitable for this type of research
RSPO3 Polyclonal Antibody
31537-100ul 100ul
EUR 252
RSPO3 Polyclonal Antibody
31537-50ul 50ul
EUR 187
Human R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Hu-48T 48T
EUR 554
  • Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids.
Human R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Hu-96T 96T
EUR 725
  • Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Mu-48T 48T
EUR 566
  • Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Mu-96T 96T
EUR 741
  • Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Hu-48Tests 48 Tests
EUR 563
Human R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Hu-96Tests 96 Tests
EUR 783
Mouse R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Mu-48Tests 48 Tests
EUR 577
Mouse R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Mu-96Tests 96 Tests
EUR 802
Human R-Spondin 3 (RSPO3) ELISA Kit
RDR-RSPO3-Hu-48Tests 48 Tests
EUR 589
Human R-Spondin 3 (RSPO3) ELISA Kit
RDR-RSPO3-Hu-96Tests 96 Tests
EUR 820
RSPO3 Rabbit pAb
A8389-100ul 100 ul
EUR 308
RSPO3 Rabbit pAb
A8389-200ul 200 ul
EUR 459
RSPO3 Rabbit pAb
A8389-20ul 20 ul
EUR 183
RSPO3 Rabbit pAb
A8389-50ul 50 ul
EUR 223
RSPO3 Polyclonal Conjugated Antibody
C31537 100ul
EUR 397
RSPO3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
RSPO3 Antibody
DF12728 200ul
EUR 304
Description: RSPO3 Antibody detects endogenous levels of RSPO3.
Polyclonal RSPO3 Antibody (internal region)
APG00723G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RSPO3 (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal RSPO3 Antibody (C-Term)
APR04974G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO3 (C-Term). This antibody is tested and proven to work in the following applications:
RSPO3 Polyclonal Antibody, Biotin Conjugated
A60723 100 µg
EUR 570.55
Description: kits suitable for this type of research
RSPO3 Polyclonal Antibody, FITC Conjugated
A60724 100 µg
EUR 570.55
Description: fast delivery possible
RSPO3 Polyclonal Antibody, HRP Conjugated
A60725 100 µg
EUR 570.55
Description: reagents widely cited
RSPO3 Polyclonal Antibody, HRP Conjugated
A67931 100 µg
EUR 570.55
Description: fast delivery possible
RSPO3 Polyclonal Antibody, FITC Conjugated
A67932 100 µg
EUR 570.55
Description: reagents widely cited
RSPO3 Polyclonal Antibody, Biotin Conjugated
A67933 100 µg
EUR 570.55
Description: Ask the seller for details
anti- RSPO3 antibody
FNab07512 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:400
  • Immunogen: R-spondin 3 homolog
  • Uniprot ID: Q9BXY4
  • Gene ID: 84870
  • Research Area: Neuroscience
Description: Antibody raised against RSPO3
Anti-RSPO3 antibody
PAab07512 100 ug
EUR 386
Anti-RSPO3 antibody
STJ110687 100 µl
EUR 277
Description: This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development.
Anti-RSPO3 antibody
STJ192360 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RSPO3
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RSPO3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RSPO3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RSPO3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig)
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3)
RSPO3 Blocking Peptide
DF12728-BP 1mg
EUR 195
RSPO3 cloning plasmid
CSB-CL887154HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgcacttgcgactgatttcttggctttttatcattttgaactttatggaatacatcggcagccaaaacgcctcccggggaaggcgccagcgaagaatgcatcctaacgttagtcaaggctgccaaggaggctgtgcaacatgctcagattacaatggatgtttgtcatgtaagcc
  • Show more
Description: A cloning plasmid for the RSPO3 gene.
R-Spondin 3 (RSPO3) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
R-Spondin 3 (RSPO3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
R-Spondin 3 (RSPO3) Antibody
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
R-Spondin 3 (RSPO3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
R-Spondin 3 (RSPO3) Antibody
abx432159-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

RSPO3 Rabbit Polyclonal Antibody