RSPO3 Rabbit Polyclonal Antibody
RSPO3 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
RSPO3 Polyclonal Antibody |
31537-50ul |
SAB |
50ul |
EUR 187 |
Polyclonal RSPO3 Antibody |
APR06910G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO3 . This antibody is tested and proven to work in the following applications: |
RSPO3 Polyclonal Antibody |
A67930 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
RSPO3 Polyclonal Antibody |
A60722 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
RSPO3 Polyclonal Antibody |
ABP60272-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein |
RSPO3 Polyclonal Antibody |
ABP60272-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein |
RSPO3 Polyclonal Antibody |
ABP60272-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein |
RSPO3 Polyclonal Antibody |
ES11202-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RSPO3 Polyclonal Antibody |
ES11202-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human R-Spondin 3 (RSPO3) ELISA Kit |
DLR-RSPO3-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human R-Spondin 3 (RSPO3) ELISA Kit |
DLR-RSPO3-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse R-Spondin 3 (RSPO3) ELISA Kit |
DLR-RSPO3-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse R-Spondin 3 (RSPO3) ELISA Kit |
DLR-RSPO3-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human R-Spondin 3 (RSPO3) ELISA Kit |
RDR-RSPO3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human R-Spondin 3 (RSPO3) ELISA Kit |
RDR-RSPO3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human R-Spondin 3 (RSPO3) ELISA Kit |
RD-RSPO3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human R-Spondin 3 (RSPO3) ELISA Kit |
RD-RSPO3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Mouse R-Spondin 3 (RSPO3) ELISA Kit |
RD-RSPO3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse R-Spondin 3 (RSPO3) ELISA Kit |
RD-RSPO3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
RSPO3 Rabbit pAb |
A8389-100ul |
Abclonal |
100 ul |
EUR 308 |
RSPO3 Rabbit pAb |
A8389-200ul |
Abclonal |
200 ul |
EUR 459 |
RSPO3 Rabbit pAb |
A8389-20ul |
Abclonal |
20 ul |
EUR 183 |
RSPO3 Rabbit pAb |
A8389-50ul |
Abclonal |
50 ul |
EUR 223 |
RSPO3 Polyclonal Conjugated Antibody |
C31537 |
SAB |
100ul |
EUR 397 |
RSPO3 Antibody |
1-CSB-PA887154LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
RSPO3 Antibody |
DF12728 |
Affbiotech |
200ul |
EUR 304 |
Description: RSPO3 Antibody detects endogenous levels of RSPO3. |
Polyclonal RSPO3 Antibody (C-Term) |
APR04974G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO3 (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal RSPO3 Antibody (internal region) |
APG00723G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RSPO3 (internal region). This antibody is tested and proven to work in the following applications: |
RSPO3 Polyclonal Antibody, HRP Conjugated |
A67931 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
RSPO3 Polyclonal Antibody, FITC Conjugated |
A67932 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
RSPO3 Polyclonal Antibody, Biotin Conjugated |
A67933 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
RSPO3 Polyclonal Antibody, Biotin Conjugated |
A60723 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
RSPO3 Polyclonal Antibody, FITC Conjugated |
A60724 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
RSPO3 Polyclonal Antibody, HRP Conjugated |
A60725 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
anti- RSPO3 antibody |
FNab07512 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:1000
- IHC: 1:100-1:400
- Immunogen: R-spondin 3 homolog
- Uniprot ID: Q9BXY4
- Gene ID: 84870
- Research Area: Neuroscience
|
Description: Antibody raised against RSPO3 |
Anti-RSPO3 antibody |
STJ110687 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. |
Anti-RSPO3 antibody |
STJ192360 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RSPO3 |
RSPO3 siRNA |
20-abx932215 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RSPO3 siRNA |
20-abx932216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RSPO3 Antibody, HRP conjugated |
1-CSB-PA887154LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RSPO3 Antibody, FITC conjugated |
1-CSB-PA887154LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RSPO3 Antibody, Biotin conjugated |
1-CSB-PA887154LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig) |
4-PAM173Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RSPO3 (Gln22~His272)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3) |
RSPO3 Blocking Peptide |
DF12728-BP |
Affbiotech |
1mg |
EUR 195 |
RSPO3 cloning plasmid |
CSB-CL887154HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 819
- Sequence: atgcacttgcgactgatttcttggctttttatcattttgaactttatggaatacatcggcagccaaaacgcctcccggggaaggcgccagcgaagaatgcatcctaacgttagtcaaggctgccaaggaggctgtgcaacatgctcagattacaatggatgtttgtcatgtaagcc
- Show more
|
Description: A cloning plasmid for the RSPO3 gene. |
R-Spondin 3 (RSPO3) Antibody |
20-abx007316 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
R-Spondin 3 (RSPO3) Antibody |
20-abx129057 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
R-Spondin 3 (RSPO3) Antibody |
20-abx174431 |
Abbexa |
|
|
|
R-Spondin 3 (RSPO3) Antibody |
abx237512-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
R-Spondin 3 (RSPO3) Antibody |
abx432159-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
RSPO3 Rabbit Polyclonal Antibody