NR4A2 Rabbit Polyclonal Antibody

NR4A2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

NR4A2 Polyclonal Antibody

ES11283-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR4A2 Polyclonal Antibody

ES11283-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR4A2 Rabbit pAb

A17318-100ul 100 ul
EUR 308

NR4A2 Rabbit pAb

A17318-200ul 200 ul
EUR 459

NR4A2 Rabbit pAb

A17318-20ul 20 ul
EUR 183

NR4A2 Rabbit pAb

A17318-50ul 50 ul
EUR 223

Polyclonal NR4A2 Antibody (Center)

APR08823G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 (Center). This antibody is tested and proven to work in the following applications:

NR4A2 antibody

70R-18956 50 ul
EUR 435
Description: Rabbit polyclonal NR4A2 antibody

NR4A2 Antibody

35847-100ul 100ul
EUR 252

NR4A2 antibody

10R-1497 50 ug
EUR 242
Description: Mouse monoclonal NR4A2 antibody

NR4A2 Antibody

1-CSB-PA949280
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

NR4A2 Antibody

1-CSB-PA449475
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NR4A2 Antibody

1-CSB-PA016063GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Polyclonal NURR1 (NR4A2) Antibody (N-term)

APR10842G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NURR1 (NR4A2) (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal NR4A2 antibody - C-terminal region

APR08828G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Nr4a2/ Rat Nr4a2 ELISA Kit

ELI-36911r 96 Tests
EUR 886

Nurr1/NR4A2 Antibody

DF12678 200ul
EUR 304
Description: Nurr1/NR4A2 Antibody detects endogenous levels of Nurr1/NR4A2.

NR4A2 Conjugated Antibody

C35847 100ul
EUR 397

Anti-NR4A2 antibody

STJ119448 100 µl
EUR 277
Description: This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

Anti-NR4A2 Antibody

STJ501990 100 µg
EUR 476

Anti-NR4A2 antibody

STJ192441 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR4A2

NR4A2 siRNA

20-abx903651
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR4A2 siRNA

20-abx926353
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR4A2 siRNA

20-abx926354
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti- Nurr1/NR4A2 antibody

FNab05936 100µg
EUR 585
  • Immunogen: nuclear receptor subfamily 4, group A, member 2
  • Uniprot ID: P43354
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against Nurr1/NR4A2

Anti-Nurr1/NR4A2 antibody

PAab05936 100 ug
EUR 412

Anti-Nurr1/NR4A2 Antibody

PB9297 100ug/vial
EUR 294

Anti-NR4A2 Antibody (Biotin)

STJ501991 100 µg
EUR 586

Anti-NR4A2 Antibody (FITC)

STJ501992 100 µg
EUR 586

NR4A2 cloning plasmid

CSB-CL016063HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1797
  • Sequence: atgccttgtgttcaggcgcagtatgggtcctcgcctcaaggagccagccccgcttctcagagctacagttaccactcttcgggagaatacagctccgatttcttaactccagagtttgtcaagtttagcatggacctcaccaacactgaaatcactgccaccacttctctcccca
  • Show more
Description: A cloning plasmid for the NR4A2 gene.

Anti-NR4A2 (4A6)

YF-MA20377 200 ul
EUR 363
Description: Mouse monoclonal to NR4A2

Nurr1/NR4A2 Blocking Peptide

DF12678-BP 1mg
EUR 195

Mouse Nr4a2 ELISA KIT

ELI-16678m 96 Tests
EUR 865

Human NR4A2 ELISA KIT

ELI-22256h 96 Tests
EUR 824

Bovine NR4A2 ELISA KIT

ELI-46140b 96 Tests
EUR 928

Mouse NR4A2 shRNA Plasmid

20-abx971844
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NR4A2 shRNA Plasmid

20-abx985815
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NR4A2 shRNA Plasmid

20-abx953279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR4A2 Recombinant Protein (Human)

RP021625 100 ug Ask for price

NR4A2 Recombinant Protein (Mouse)

RP154928 100 ug Ask for price

NR4A2 Recombinant Protein (Mouse)

RP154931 100 ug Ask for price

NR4A2 Recombinant Protein (Rat)

RP214481 100 ug Ask for price

Intermediate-Early Receptor Protein (NR4A2) Antibody

abx235936-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Monoclonal NR4A2 Antibody (monoclonal) (M02), Clone: 1G6

APR08824G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G6. This antibody is applicable in WB and IF, E

Monoclonal NR4A2 Antibody (monoclonal) (M07), Clone: 4A6

APR08825G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 4A6. This antibody is applicable in WB and IF, E

Monoclonal NR4A2 Antibody (monoclonal) (M08), Clone: 2G5

APR08826G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2G5. This antibody is applicable in WB and IF

Monoclonal NR4A2 Antibody (monoclonal) (M10), Clone: 1C6

APR08827G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M10). The antibodies are raised in mouse and are from clone 1C6. This antibody is applicable in WB and IF, E

Nurr1/NR4A2 ELISA KIT|Human

EF001401 96 Tests
EUR 689

Nr4a2 ORF Vector (Rat) (pORF)

ORF071495 1.0 ug DNA
EUR 506

NR4A2 ORF Vector (Human) (pORF)

ORF007209 1.0 ug DNA
EUR 95

Nr4a2 ORF Vector (Mouse) (pORF)

ORF051644 1.0 ug DNA
EUR 506

Nr4a2 ORF Vector (Mouse) (pORF)

ORF051645 1.0 ug DNA
EUR 506

pECMV-Nr4a2-m-FLAG Plasmid

PVT14939 2 ug
EUR 325

pECMV-Nr4a2-m-FLAG Plasmid

PVT15055 2 ug
EUR 325

NR4A2 ELISA Kit (Mouse) (OKCA01737)

OKCA01737 96 Wells
EUR 846
Description: Description of target: Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. It is crucial for expression of a set of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 1.56 pg/mL

NR4A2 ELISA Kit (Human) (OKEH03465)

OKEH03465 96 Wells
EUR 779
Description: Description of target: Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. It is crucial for expression of a set of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

Nr4a2 sgRNA CRISPR Lentivector set (Rat)

K6907301 3 x 1.0 ug
EUR 339

Nr4a2 sgRNA CRISPR Lentivector set (Mouse)

K4838101 3 x 1.0 ug
EUR 339

NR4A2 sgRNA CRISPR Lentivector set (Human)

K1453201 3 x 1.0 ug
EUR 339

Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6907302 1.0 ug DNA
EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6907303 1.0 ug DNA
EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6907304 1.0 ug DNA
EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4838102 1.0 ug DNA
EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4838103 1.0 ug DNA
EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4838104 1.0 ug DNA
EUR 154

NR4A2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1453202 1.0 ug DNA
EUR 154

NR4A2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1453203 1.0 ug DNA
EUR 154

NR4A2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1453204 1.0 ug DNA
EUR 154

NR4A2 Protein Vector (Rat) (pPB-C-His)

PV285978 500 ng
EUR 603

NR4A2 Protein Vector (Rat) (pPB-N-His)

PV285979 500 ng
EUR 603

NR4A2 Protein Vector (Rat) (pPM-C-HA)

PV285980 500 ng
EUR 603

NR4A2 Protein Vector (Rat) (pPM-C-His)

PV285981 500 ng
EUR 603

NR4A2 Protein Vector (Mouse) (pPB-C-His)

PV206574 500 ng
EUR 603

NR4A2 Protein Vector (Mouse) (pPB-N-His)

PV206575 500 ng
EUR 603

NR4A2 Protein Vector (Mouse) (pPM-C-HA)

PV206576 500 ng
EUR 603

NR4A2 Protein Vector (Mouse) (pPM-C-His)

PV206577 500 ng
EUR 603

NR4A2 Protein Vector (Mouse) (pPB-C-His)

PV206578 500 ng
EUR 603

NR4A2 Protein Vector (Mouse) (pPB-N-His)

PV206579 500 ng
EUR 603

NR4A2 Protein Vector (Mouse) (pPM-C-HA)

PV206580 500 ng
EUR 603

NR4A2 Protein Vector (Mouse) (pPM-C-His)

PV206581 500 ng
EUR 603

NR4A2 Protein Vector (Human) (pPB-C-His)

PV028833 500 ng
EUR 329

NR4A2 Protein Vector (Human) (pPB-N-His)

PV028834 500 ng
EUR 329

NR4A2 Protein Vector (Human) (pPM-C-HA)

PV028835 500 ng
EUR 329

NR4A2 Protein Vector (Human) (pPM-C-His)

PV028836 500 ng
EUR 329

Nr4a2 3'UTR Luciferase Stable Cell Line

TU114304 1.0 ml Ask for price

Nr4a2 3'UTR GFP Stable Cell Line

TU164304 1.0 ml Ask for price

Nr4a2 3'UTR Luciferase Stable Cell Line

TU214172 1.0 ml Ask for price

Nr4a2 3'UTR GFP Stable Cell Line

TU264172 1.0 ml Ask for price

NR4A2 3'UTR GFP Stable Cell Line

TU065951 1.0 ml
EUR 1394

NR4A2 3'UTR Luciferase Stable Cell Line

TU015951 1.0 ml
EUR 1394

Nuclear receptor subfamily 4 group A member 2 (NR4A2) Antibody

20-abx213782
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 4, Group A, Member 2 (NR4A2) Antibody

20-abx114199
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear receptor subfamily 4 group A member 2 (NR4A2) Antibody

20-abx241582
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NR4A2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV695053 1.0 ug DNA
EUR 682

NR4A2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695057 1.0 ug DNA
EUR 682

NR4A2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV695058 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NR4A2 Rabbit Polyclonal Antibody