PI16 Rabbit Polyclonal Antibody

PI16 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PI16 Polyclonal Antibody
ES10979-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PI16 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
DLR-PI16-Hu-48T	DL Develop	48T	EUR 554
Should the Human Peptidase Inhibitor 16 (PI16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidase Inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
DLR-PI16-Hu-96T	DL Develop	96T	EUR 725
Should the Human Peptidase Inhibitor 16 (PI16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidase Inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
RDR-PI16-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
RDR-PI16-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
RD-PI16-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
RD-PI16-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

PI16 antibody
70R-19271	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PI16 antibody

PI16 Antibody
1-CSB-PA017951GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PI16. Recognizes PI16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PI16 antibody
70R-6245	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PI16 antibody raised against the middle region of PI16

anti- PI16 antibody
FNab06415	FN Test	100µg	EUR 585
Immunogen: peptidase inhibitor 16 Uniprot ID: Q6UXB8 Gene ID: 221476 Research Area: Immunology, Metabolism
Description: Antibody raised against PI16

Anti-PI16 antibody
PAab06415	Lifescience Market	100 ug	EUR 412

Anti-PI16 antibody
STJ192137	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PI16

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine)
4-PAQ943Bo01	Cloud-Clone	EUR 293.00 EUR 3249.00 EUR 793.00 EUR 377.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Pro442) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16)

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human)
4-PAQ943Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Gly440) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16)

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse)
4-PAQ943Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu21~Lys468) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16)

PI16 siRNA
20-abx928519	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PI16 siRNA
20-abx928520	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), APC
4-PAQ943Bo01-APC	Cloud-Clone	EUR 415.00 EUR 4283.00 EUR 1164.00 EUR 540.00 EUR 250.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Pro442) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), Biotinylated
4-PAQ943Bo01-Biotin	Cloud-Clone	EUR 363.00 EUR 3199.00 EUR 912.00 EUR 454.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Pro442) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with Biotin.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), Cy3
4-PAQ943Bo01-Cy3	Cloud-Clone	EUR 512.00 EUR 5669.00 EUR 1511.00 EUR 679.00 EUR 291.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Pro442) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with Cy3.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), FITC
4-PAQ943Bo01-FITC	Cloud-Clone	EUR 352.00 EUR 3446.00 EUR 951.00 EUR 452.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Pro442) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with FITC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), HRP
4-PAQ943Bo01-HRP	Cloud-Clone	EUR 376.00 EUR 3728.00 EUR 1025.00 EUR 485.00 EUR 233.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Pro442) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with HRP.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), PE
4-PAQ943Bo01-PE	Cloud-Clone	EUR 352.00 EUR 3446.00 EUR 951.00 EUR 452.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Pro442) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with PE.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), APC
4-PAQ943Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Gly440) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), Biotinylated
4-PAQ943Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Gly440) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with Biotin.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), Cy3
4-PAQ943Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Gly440) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with Cy3.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), FITC
4-PAQ943Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Gly440) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with FITC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), HRP
4-PAQ943Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Gly440) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with HRP.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), PE
4-PAQ943Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Gly440) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with PE.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), APC
4-PAQ943Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu21~Lys468) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), Biotinylated
4-PAQ943Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu21~Lys468) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with Biotin.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), Cy3
4-PAQ943Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu21~Lys468) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with Cy3.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), FITC
4-PAQ943Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu21~Lys468) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with FITC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), HRP
4-PAQ943Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu21~Lys468) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with HRP.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), PE
4-PAQ943Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu21~Lys468) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with PE.

PI16 Blocking Peptide
33R-8568	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PI16 antibody, catalog no. 70R-6245

PI16 cloning plasmid
CSB-CL017951HU1-10ug	Cusabio	10ug	EUR 469
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1287 Sequence: atggtggagctgcacaacctctaccgggcccaggtatccccgccggcctcagacatgctgcacatgagatgggacgaggagctggccgccttcgccaaggcctacgcacggcagtgcgtgtggggccacaacaaggagcgcgggcgccgcggcgagaatctgttcgccatcacag Show more
Description: A cloning plasmid for the PI16 gene.

PI16 cloning plasmid
CSB-CL017951HU2-10ug	Cusabio	10ug	EUR 453
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1227 Sequence: atgcacggctcctgcagtttcctgatgcttctgctgccgctactgctactgctggtggccaccacaggccccgttggagccctcacagatgaggagaaacgtttgatggtggagctgcacaacctctaccgggcccaggtatccccgacggcctcagacatgctgcacatgagat Show more
Description: A cloning plasmid for the PI16 gene.

Peptidase Inhibitor 16 (PI16) Antibody
20-abx102279	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peptidase Inhibitor 16 (PI16) Antibody
20-abx102280	Abbexa	EUR 328.00 EUR 133.00 EUR 899.00 EUR 467.00 EUR 286.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peptidase Inhibitor 16 (PI16) Antibody
20-abx104788	Abbexa	EUR 509.00 EUR 133.00 EUR 1539.00 EUR 718.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peptidase Inhibitor 16 (PI16) Antibody
20-abx173977	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Peptidase Inhibitor 16 (PI16) Antibody
abx029735-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Peptidase Inhibitor 16 (PI16) Antibody
abx029735-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Peptidase Inhibitor 16 (PI16) Antibody
20-abx270091	Abbexa	EUR 523.00 EUR 606.00 EUR 300.00 EUR 940.00 EUR 384.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-12 working days.

Peptidase Inhibitor 16 (PI16) Antibody
abx236415-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), APC-Cy7
4-PAQ943Bo01-APC-Cy7	Cloud-Clone	EUR 711.00 EUR 8446.00 EUR 2209.00 EUR 961.00 EUR 380.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Pro442) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC-Cy7.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), APC-Cy7
4-PAQ943Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu28~Gly440) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC-Cy7.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), APC-Cy7
4-PAQ943Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PI16 (Leu21~Lys468) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC-Cy7.

Peptidase Inhibitor 16 (PI16) Antibody (FITC)
20-abx270389	Abbexa	EUR 592.00 EUR 704.00 EUR 328.00 EUR 1107.00 EUR 439.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

Peptidase Inhibitor 16 (PI16) Antibody (APC)
20-abx270621	Abbexa	EUR 815.00 EUR 968.00 EUR 411.00 EUR 1567.00 EUR 565.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

Peptidase Inhibitor 16 (PI16) Antibody (PE)
20-abx270853	Abbexa	EUR 704.00 EUR 829.00 EUR 370.00 EUR 1330.00 EUR 495.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

Peptidase Inhibitor 16 (PI16) Antibody (Biotin)
20-abx271879	Abbexa	EUR 481.00 EUR 244.00 EUR 1428.00 EUR 676.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Peptidase Inhibitor 16 (PI16) Antibody (Biotin)
20-abx272981	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

PI16 ELISA KIT|Human
EF001756	Lifescience Market	96 Tests	EUR 689

Mouse PI16 shRNA Plasmid
20-abx978095	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PI16 shRNA Plasmid
20-abx966519	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PI16 Recombinant Protein (Human)
RP023398	ABM	100 ug	Ask for price

PI16 Recombinant Protein (Human)
RP023401	ABM	100 ug	Ask for price

PI16 Recombinant Protein (Mouse)
RP161930	ABM	100 ug	Ask for price

PI16 Recombinant Protein (Rat)
RP220421	ABM	100 ug	Ask for price

PI16 Rabbit Polyclonal Antibody