FKBP8 Rabbit Polyclonal Antibody
FKBP8 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
FKBP8 Polyclonal Antibody |
ABP58566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FKBP8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FKBP8 from Human, Mouse, Rat. This FKBP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP8 protein |
FKBP8 Polyclonal Antibody |
ABP58566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FKBP8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FKBP8 from Human, Mouse, Rat. This FKBP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP8 protein |
FKBP8 Rabbit pAb |
A7085-100ul |
Abclonal |
100 ul |
EUR 308 |
FKBP8 Rabbit pAb |
A7085-200ul |
Abclonal |
200 ul |
EUR 459 |
FKBP8 Rabbit pAb |
A7085-20ul |
Abclonal |
20 ul |
EUR 183 |
FKBP8 Rabbit pAb |
A7085-50ul |
Abclonal |
50 ul |
EUR 223 |
FKBP8 Rabbit pAb |
A1268-100ul |
Abclonal |
100 ul |
EUR 384 |
FKBP8 Rabbit pAb |
A1268-200ul |
Abclonal |
200 ul |
Ask for price |
FKBP8 Rabbit pAb |
A1268-20ul |
Abclonal |
20 ul |
Ask for price |
FKBP8 Rabbit pAb |
A1268-50ul |
Abclonal |
50 ul |
EUR 265 |
Polyclonal FKBP8 Antibody (Center) |
APR05693G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP8 (Center). This antibody is tested and proven to work in the following applications: |
FKBP8 antibody |
70R-5950 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FKBP8 antibody raised against the N terminal of FKBP8 |
FKBP8 antibody |
70R-5951 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FKBP8 antibody raised against the C terminal of FKBP8 |
FKBP8 Antibody |
36485-100ul |
SAB |
100ul |
EUR 252 |
FKBP8 antibody |
70R-17315 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FKBP8 antibody |
FKBP8 antibody |
70R-12792 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal FKBP8 antibody |
FKBP8 Antibody |
1-CSB-PA990771 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300 |
FKBP8 Antibody |
1-CSB-PA617913LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
FKBP8 Antibody |
1-CSB-PA008704GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
FKBP8 Antibody |
1-CSB-PA112026 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
Polyclonal FKBP8 / FKBP38 Antibody (internal region) |
APG00543G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FKBP8 / FKBP38 (internal region). This antibody is tested and proven to work in the following applications: |
FKBP8 Conjugated Antibody |
C36485 |
SAB |
100ul |
EUR 397 |
anti- FKBP8 antibody |
FNab03149 |
FN Test |
100µg |
EUR 585 |
- Immunogen: FK506 binding protein 8, 38kDa
- Uniprot ID: Q14318
- Gene ID: 23770
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against FKBP8 |
Anti-FKBP8 Antibody |
A03722 |
BosterBio |
100ug |
EUR 455 |
Description: Rabbit Polyclonal FKBP8 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Anti-FKBP8 antibody |
STJ29165 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function. |
Anti-FKBP8 antibody |
STJ23669 |
St John's Laboratory |
100 µl |
EUR 393 |
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function. |
Anti-FKBP8 antibody |
STJ192156 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FKBP8 |
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody |
20-abx001174 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody |
abx032679-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody |
abx032679-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody |
20-abx005356 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody |
20-abx318140 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody |
abx430341-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody |
20-abx225175 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody |
abx233149-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
FKBP8 siRNA |
20-abx901978 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FKBP8 siRNA |
20-abx916946 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FKBP8 siRNA |
20-abx916947 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (HRP) |
20-abx315427 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (FITC) |
20-abx315428 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (Biotin) |
20-abx315429 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
FKBP8 Antibody, HRP conjugated |
1-CSB-PA617913LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
FKBP8 Antibody, FITC conjugated |
1-CSB-PA617913LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
FKBP8 Antibody, Biotin conjugated |
1-CSB-PA617913LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human) |
4-PAE678Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Trp93~Asn339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8) |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse) |
4-PAE678Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Gly110~Ser329)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8) |
FKBP8 cloning plasmid |
CSB-CL617913HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1068
- Sequence: atgggacaacccccggcggaggaggctgagcagcctggggccctggcccgagagttccttgctgccatggagcccgagcccgccccagccccggccccagaagagtggctggacattctggggaacgggctgttgaggaagaagacgctggtcccagggccgccaggttcgagcc
- Show more
|
Description: A cloning plasmid for the FKBP8 gene. |
FKBP8 Blocking Peptide |
33R-3478 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP8 antibody, catalog no. 70R-5950 |
FKBP8 Blocking Peptide |
33R-1277 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSTM2A antibody, catalog no. 70R-5328 |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC |
4-PAE678Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Trp93~Asn339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Biotinylated |
4-PAE678Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Trp93~Asn339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Cy3 |
4-PAE678Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Trp93~Asn339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), FITC |
4-PAE678Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Trp93~Asn339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), HRP |
4-PAE678Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Trp93~Asn339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), PE |
4-PAE678Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Trp93~Asn339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), APC |
4-PAE678Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Gly110~Ser329)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Biotinylated |
4-PAE678Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Gly110~Ser329)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Cy3 |
4-PAE678Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Gly110~Ser329)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), FITC |
4-PAE678Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Gly110~Ser329)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), HRP |
4-PAE678Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Gly110~Ser329)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP. |
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), PE |
4-PAE678Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Gly110~Ser329)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE. |
Mouse Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit |
abx515305-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit |
abx515306-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit |
E0365Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit |
E0542Mo |
Sunlong |
1 Kit |
EUR 632 |
Fkbp8 ELISA Kit| Rat Peptidyl-prolyl cis-trans isomerase FKBP8 |
EF018697 |
Lifescience Market |
96 Tests |
EUR 689 |
Human FKBP8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit |
E0919Hu |
Sunlong |
1 Kit |
EUR 605 |
Human FKBP8(Peptidyl-prolyl cis-trans isomerase FKBP8) ELISA Kit |
EH1273 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q14318
- Alias: FKBP8/Rotamase/FKBPR38/38 kDa FK506-binding protein/38 kDa FKBP/FKBP-38/hFKBP38/FK506-binding protein 8/FKBP-8/peptidyl-prolyl cis-trans isomerase FKBP8/PPIase FKBP8
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit |
abx250535-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
FK506 Binding Protein 8 (FKBP8) Antibody |
20-abx112555 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FK506 Binding Protein 8 (FKBP8) Antibody |
20-abx131876 |
Abbexa |
-
EUR 342.00
-
EUR 857.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
FK506 Binding Protein 8 (FKBP8) Antibody |
20-abx102436 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
FK506 Binding Protein 8 (FKBP8) Antibody |
20-abx102437 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
FK506 Binding Protein 8 (FKBP8) Antibody |
20-abx214978 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FK506 Binding Protein 8 (FKBP8) Antibody |
20-abx242278 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC-Cy7 |
4-PAE678Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP8 (Trp93~Asn339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC-Cy7. |
FKBP8 Rabbit Polyclonal Antibody