FKBP8 Rabbit Polyclonal Antibody

FKBP8 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FKBP8 Polyclonal Antibody
ES10998-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FKBP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP8 Polyclonal Antibody
ES10998-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FKBP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP8 Rabbit pAb
A1268-100ul	Abclonal	100 ul	EUR 384

FKBP8 Rabbit pAb
A1268-200ul	Abclonal	200 ul	Ask for price

FKBP8 Rabbit pAb
A1268-20ul	Abclonal	20 ul	Ask for price

FKBP8 Rabbit pAb
A1268-50ul	Abclonal	50 ul	EUR 265

FKBP8 Rabbit pAb
A7085-100ul	Abclonal	100 ul	EUR 308

FKBP8 Rabbit pAb
A7085-200ul	Abclonal	200 ul	EUR 459

FKBP8 Rabbit pAb
A7085-20ul	Abclonal	20 ul	EUR 183

FKBP8 Rabbit pAb
A7085-50ul	Abclonal	50 ul	EUR 223

Polyclonal FKBP8 Antibody (Center)
APR05693G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP8 (Center). This antibody is tested and proven to work in the following applications:

FKBP8 antibody
70R-17315	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FKBP8 antibody

FKBP8 antibody
70R-12792	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal FKBP8 antibody

FKBP8 Antibody
36485-100ul	SAB	100ul	EUR 252

FKBP8 Antibody
1-CSB-PA112026	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FKBP8 Antibody
1-CSB-PA617913LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FKBP8 Antibody
1-CSB-PA990771	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

FKBP8 antibody
70R-5950	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FKBP8 antibody raised against the N terminal of FKBP8

FKBP8 antibody
70R-5951	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FKBP8 antibody raised against the C terminal of FKBP8

FKBP8 Antibody
1-CSB-PA008704GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal FKBP8 / FKBP38 Antibody (internal region)
APG00543G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FKBP8 / FKBP38 (internal region). This antibody is tested and proven to work in the following applications:

Anti-FKBP8 Antibody
A03722	BosterBio	100ug	EUR 455
Description: Rabbit Polyclonal FKBP8 Antibody. Validated in WB and tested in Human, Mouse, Rat.

FKBP8 Conjugated Antibody
C36485	SAB	100ul	EUR 397

anti- FKBP8 antibody
FNab03149	FN Test	100µg	EUR 585
Immunogen: FK506 binding protein 8, 38kDa Uniprot ID: Q14318 Gene ID: 23770 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against FKBP8

Anti-FKBP8 antibody
PAab03149	Lifescience Market	100 ug	EUR 412

Anti-FKBP8 antibody
STJ29165	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function.

Anti-FKBP8 antibody
STJ23669	St John's Laboratory	100 µl	EUR 393
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function.

Anti-FKBP8 antibody
STJ192156	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FKBP8

Fkbp8/ Rat Fkbp8 ELISA Kit
ELI-26710r	Lifescience Market	96 Tests	EUR 886

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
20-abx005356	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
abx032679-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
abx032679-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
abx233149-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
20-abx318140	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
abx430341-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
20-abx225175	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
20-abx001174	Abbexa	EUR 495.00 EUR 356.00	100 ul 50 ul
Shipped within 5-10 working days.

FKBP8 siRNA
20-abx901978	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FKBP8 siRNA
20-abx916946	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FKBP8 siRNA
20-abx916947	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (HRP)
20-abx315427	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (FITC)
20-abx315428	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (Biotin)
20-abx315429	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

FKBP8 Antibody, HRP conjugated
1-CSB-PA617913LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FKBP8 Antibody, FITC conjugated
1-CSB-PA617913LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FKBP8 Antibody, Biotin conjugated
1-CSB-PA617913LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-FKBP8 / FKBP38 antibody
STJ71583	St John's Laboratory	100 µg	EUR 260

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human)
4-PAE678Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8)

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse)
4-PAE678Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8)

FKBP8 Blocking Peptide
33R-3478	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP8 antibody, catalog no. 70R-5950

FKBP8 Blocking Peptide
33R-1277	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSTM2A antibody, catalog no. 70R-5328

FKBP8 cloning plasmid
CSB-CL617913HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1068 Sequence: atgggacaacccccggcggaggaggctgagcagcctggggccctggcccgagagttccttgctgccatggagcccgagcccgccccagccccggccccagaagagtggctggacattctggggaacgggctgttgaggaagaagacgctggtcccagggccgccaggttcgagcc Show more
Description: A cloning plasmid for the FKBP8 gene.

pET28a-FKBP8 vector
PVT11986	Lifescience Market	2 ug	EUR 352

pENTR223-FKBP8 vector
PVT12085	Lifescience Market	2 ug	EUR 308

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC
4-PAE678Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Biotinylated
4-PAE678Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Cy3
4-PAE678Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), FITC
4-PAE678Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), HRP
4-PAE678Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), PE
4-PAE678Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), APC
4-PAE678Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Biotinylated
4-PAE678Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Cy3
4-PAE678Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), FITC
4-PAE678Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), HRP
4-PAE678Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), PE
4-PAE678Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE.

Rat Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit
E0365Ra	Sunlong	1 Kit	EUR 646

Mouse Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit
E0542Mo	Sunlong	1 Kit	EUR 632

Human Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit
abx250535-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human FKBP8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit
E0919Hu	Sunlong	1 Kit	EUR 605

Human FKBP8(Peptidyl-prolyl cis-trans isomerase FKBP8) ELISA Kit
EH1273	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q14318 Alias: FKBP8/Rotamase/FKBPR38/38 kDa FK506-binding protein/38 kDa FKBP/FKBP-38/hFKBP38/FK506-binding protein 8/FKBP-8/peptidyl-prolyl cis-trans isomerase FKBP8/PPIase FKBP8
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Fkbp8 ELISA Kit| Rat Peptidyl-prolyl cis-trans isomerase FKBP8
EF018697	Lifescience Market	96 Tests	EUR 689

Mouse Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit
abx515305-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit
abx515306-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx214978	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx102436	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx102437	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx112555	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx131876	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx242278	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC-Cy7
4-PAE678Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC-Cy7.

FKBP8 Rabbit Polyclonal Antibody