FKBP8 Rabbit Polyclonal Antibody

FKBP8 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FKBP8 Polyclonal Antibody

ES10998-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FKBP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP8 Polyclonal Antibody

ES10998-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FKBP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP8 Rabbit pAb

A1268-100ul 100 ul
EUR 384

FKBP8 Rabbit pAb

A1268-200ul 200 ul Ask for price

FKBP8 Rabbit pAb

A1268-20ul 20 ul Ask for price

FKBP8 Rabbit pAb

A1268-50ul 50 ul
EUR 265

FKBP8 Rabbit pAb

A7085-100ul 100 ul
EUR 308

FKBP8 Rabbit pAb

A7085-200ul 200 ul
EUR 459

FKBP8 Rabbit pAb

A7085-20ul 20 ul
EUR 183

FKBP8 Rabbit pAb

A7085-50ul 50 ul
EUR 223

Polyclonal FKBP8 Antibody (Center)

APR05693G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP8 (Center). This antibody is tested and proven to work in the following applications:

FKBP8 antibody

70R-17315 50 ul
EUR 435
Description: Rabbit polyclonal FKBP8 antibody

FKBP8 antibody

70R-12792 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal FKBP8 antibody

FKBP8 Antibody

36485-100ul 100ul
EUR 252

FKBP8 Antibody

1-CSB-PA112026
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FKBP8 Antibody

1-CSB-PA617913LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FKBP8 Antibody

1-CSB-PA990771
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

FKBP8 antibody

70R-5950 50 ug
EUR 467
Description: Rabbit polyclonal FKBP8 antibody raised against the N terminal of FKBP8

FKBP8 antibody

70R-5951 50 ug
EUR 467
Description: Rabbit polyclonal FKBP8 antibody raised against the C terminal of FKBP8

FKBP8 Antibody

1-CSB-PA008704GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal FKBP8 / FKBP38 Antibody (internal region)

APG00543G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FKBP8 / FKBP38 (internal region). This antibody is tested and proven to work in the following applications:

Anti-FKBP8 Antibody

A03722 100ug
EUR 455
Description: Rabbit Polyclonal FKBP8 Antibody. Validated in WB and tested in Human, Mouse, Rat.

FKBP8 Conjugated Antibody

C36485 100ul
EUR 397

anti- FKBP8 antibody

FNab03149 100µg
EUR 585
  • Immunogen: FK506 binding protein 8, 38kDa
  • Uniprot ID: Q14318
  • Gene ID: 23770
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against FKBP8

Anti-FKBP8 antibody

PAab03149 100 ug
EUR 412

Anti-FKBP8 antibody

STJ29165 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function.

Anti-FKBP8 antibody

STJ23669 100 µl
EUR 393
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function.

Anti-FKBP8 antibody

STJ192156 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FKBP8

Fkbp8/ Rat Fkbp8 ELISA Kit

ELI-26710r 96 Tests
EUR 886

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

20-abx005356
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

abx032679-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

abx032679-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

abx233149-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

20-abx318140
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

abx430341-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

20-abx225175
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

20-abx001174
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FKBP8 siRNA

20-abx901978
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FKBP8 siRNA

20-abx916946
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FKBP8 siRNA

20-abx916947
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (HRP)

20-abx315427
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (FITC)

20-abx315428
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (Biotin)

20-abx315429
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FKBP8 Antibody, HRP conjugated

1-CSB-PA617913LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FKBP8 Antibody, FITC conjugated

1-CSB-PA617913LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FKBP8 Antibody, Biotin conjugated

1-CSB-PA617913LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-FKBP8 / FKBP38 antibody

STJ71583 100 µg
EUR 260

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human)

4-PAE678Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8)

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse)

4-PAE678Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8)

FKBP8 Blocking Peptide

33R-3478 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP8 antibody, catalog no. 70R-5950

FKBP8 Blocking Peptide

33R-1277 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSTM2A antibody, catalog no. 70R-5328

FKBP8 cloning plasmid

CSB-CL617913HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atgggacaacccccggcggaggaggctgagcagcctggggccctggcccgagagttccttgctgccatggagcccgagcccgccccagccccggccccagaagagtggctggacattctggggaacgggctgttgaggaagaagacgctggtcccagggccgccaggttcgagcc
  • Show more
Description: A cloning plasmid for the FKBP8 gene.

pET28a-FKBP8 vector

PVT11986 2 ug
EUR 352

pENTR223-FKBP8 vector

PVT12085 2 ug
EUR 308

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC

4-PAE678Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Biotinylated

4-PAE678Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Cy3

4-PAE678Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), FITC

4-PAE678Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), HRP

4-PAE678Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), PE

4-PAE678Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), APC

4-PAE678Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Biotinylated

4-PAE678Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Cy3

4-PAE678Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), FITC

4-PAE678Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), HRP

4-PAE678Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), PE

4-PAE678Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE.

Rat Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit

E0365Ra 1 Kit
EUR 646

Mouse Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit

E0542Mo 1 Kit
EUR 632

Human Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit

abx250535-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human FKBP8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit

E0919Hu 1 Kit
EUR 605

Human FKBP8(Peptidyl-prolyl cis-trans isomerase FKBP8) ELISA Kit

EH1273 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q14318
  • Alias: FKBP8/Rotamase/FKBPR38/38 kDa FK506-binding protein/38 kDa FKBP/FKBP-38/hFKBP38/FK506-binding protein 8/FKBP-8/peptidyl-prolyl cis-trans isomerase FKBP8/PPIase FKBP8
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Fkbp8 ELISA Kit| Rat Peptidyl-prolyl cis-trans isomerase FKBP8

EF018697 96 Tests
EUR 689

Mouse Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit

abx515305-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit

abx515306-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

20-abx214978
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

20-abx102436
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

20-abx102437
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

20-abx112555
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

20-abx131876
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

20-abx242278
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC-Cy7

4-PAE678Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC-Cy7.

FKBP8 Rabbit Polyclonal Antibody