GNLY Rabbit Polyclonal Antibody
GNLY Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
Human Granulysin (GNLY) ELISA Kit |
RDR-GNLY-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Granulysin (GNLY) ELISA Kit |
RDR-GNLY-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
GNLY Polyclonal Antibody |
ES11035-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNLY Polyclonal Antibody |
ES11035-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNLY Polyclonal Antibody |
ABP58659-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
GNLY Polyclonal Antibody |
ABP58659-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
GNLY Polyclonal Antibody |
ABP58659-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
GNLY Antibody |
43674-100ul |
SAB |
100ul |
EUR 252 |
Rabbit Granulysin (GNLY) ELISA Kit |
abx355341-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
GNLY Conjugated Antibody |
C43674 |
SAB |
100ul |
EUR 397 |
Granulysin (GNLY) Antibody |
abx027191-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Granulysin (GNLY) Antibody |
abx027191-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Granulysin (GNLY) Antibody |
20-abx172666 |
Abbexa |
|
|
|
Granulysin (GNLY) Antibody |
20-abx176697 |
Abbexa |
|
|
|
Anti-GNLY antibody |
STJ192193 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GNLY |
GNLY siRNA |
20-abx918218 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-GNLY |
YF-PA17076 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to GNLY |
GNLY cloning plasmid |
CSB-CL009627HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 438
- Sequence: atggctacctgggccctcctgctccttgcagccatgctcctgggcaacccaggtctggtcttctctcgtctgagccctgagtactacgacctggcaagagcccacctgcgtgatgaggagaaatcctgcccgtgcctggcccaggagggcccccagggtgacctgttgaccaaaac
- Show more
|
Description: A cloning plasmid for the GNLY gene. |
Granulysin (GNLY) Protein |
20-abx262124 |
Abbexa |
-
EUR 328.00
-
EUR 5089.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Anti-GNLY (2A6) |
YF-MA17387 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GNLY |
Human Granulysin (GNLY) Protein |
20-abx653629 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 384.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human GNLY shRNA Plasmid |
20-abx957198 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GNLY Recombinant Protein (Human) |
RP013579 |
ABM |
100 ug |
Ask for price |
Human Granulysin (GNLY) ELISA Kit |
abx571955-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human GNLY/ Granulysin ELISA Kit |
E1028Hu |
Sunlong |
1 Kit |
EUR 571 |
Human GNLY(Granulysin) ELISA Kit |
EH0156 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.234-15 ng/ml
- Uniprot ID: P22749
- Alias: GNLY(Granulysin)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.141 ng/ml |
Human Granulysin (GNLY) ELISA Kit |
20-abx151728 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Chicken Granulysin (GNLY) ELISA Kit |
abx354664-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Granulysin (GNLY) ELISA Kit |
abx354943-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Granulysin (GNLY) ELISA Kit |
abx355092-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Granulysin (GNLY) CLIA Kit |
20-abx492830 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Granulysin (GNLY) ELISA Kit |
abx250848-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Granulysin (GNLY) CLIA Kit |
abx197066-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human granulysin,GNLY ELISA Kit |
201-12-0355 |
SunredBio |
96 tests |
EUR 440 |
- This granulysin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human granulysin, GNLY ELISA Kit |
CSB-E09936h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human granulysin, GNLY ELISA Kit |
1-CSB-E09936h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
GNLY ORF Vector (Human) (pORF) |
ORF004527 |
ABM |
1.0 ug DNA |
EUR 95 |
GNLY Granulysin Human Recombinant Protein |
PROTP22749 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: GNLY Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 159 amino acids and fused to a double His Tag (N+C terminus) and having a total molecular mass of 18.1 kDa.;The GNLY is purified by proprietary chromatographic techniques. |
Human Granulysin (GNLY) ELISA Kit |
SEB517Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
SEB517Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
SEB517Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
SEB517Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
4-SEB517Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granulysin elisa. Alternative names of the recognized antigen: NKG5
- LAG-2
- TLA519
- T-Lymphocyte Activation Gene 519
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granulysin (GNLY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Granulysin ELISA Kit (GNLY) |
RK01482 |
Abclonal |
96 Tests |
EUR 521 |
GNLY ELISA Kit (Human) (OKAN05019) |
OKAN05019 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL |
GNLY ELISA Kit (Human) (OKBB01536) |
OKBB01536 |
Aviva Systems Biology |
96 Wells |
EUR 570 |
Description: Description of target: Granulysin is a substance released by cytotoxic T cells(CD8) when they are attached to infected body cells. The product of this gene is a member of the saposin-like protein(SAPLIP) family. It is mapped to 2p11.2. Granulysin functions to create holes in the target cell membrane and destroy it. It is able to induce apoptosis in target cells and also has antimicrobial action. This gene is expressed in cytolytic granules with perforin, a pore forming protein, and granzymes that are also involved in cytolysis. In addition to it, Granulysin is broadly antimicrobial, killing microbes that cause, for example, tuberculosis and malaria, and can destroy some tumors. A series of peptides generated from the amino acid sequence of Granulysin are potential antibiotics. It has been found that secretory Granulysin is a key molecule responsible for the disseminated keratinocyte death in SJS/TEN.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
GNLY ELISA Kit (Human) (OKCD07459) |
OKCD07459 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.08ng/mL |
ELISA kit for Human GNLY (Granulysin) |
ELK2059 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granulysin (GNLY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granulysin (GNLY
- Show more
|
Description: A sandwich ELISA kit for detection of Granulysin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
GNLY sgRNA CRISPR Lentivector set (Human) |
K0878801 |
ABM |
3 x 1.0 ug |
EUR 339 |
CLIA kit for Human GNLY (Granulysin) |
E-CL-H1038 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's GNLY CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human GNLY (Granulysin) |
E-EL-H1618 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GNLY ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant |
GNLY sgRNA CRISPR Lentivector (Human) (Target 1) |
K0878802 |
ABM |
1.0 ug DNA |
EUR 154 |
GNLY sgRNA CRISPR Lentivector (Human) (Target 2) |
K0878803 |
ABM |
1.0 ug DNA |
EUR 154 |
GNLY sgRNA CRISPR Lentivector (Human) (Target 3) |
K0878804 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human GNLY Protein, His, E.coli-10ug |
QP12021-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human GNLY Protein, His, E.coli-1mg |
QP12021-1mg |
EnQuireBio |
1mg |
EUR 4153 |
Recombinant Human GNLY Protein, His, E.coli-2ug |
QP12021-2ug |
EnQuireBio |
2ug |
EUR 155 |
GNLY Protein Vector (Human) (pPB-C-His) |
PV018105 |
ABM |
500 ng |
EUR 329 |
GNLY Protein Vector (Human) (pPB-N-His) |
PV018106 |
ABM |
500 ng |
EUR 329 |
GNLY Protein Vector (Human) (pPM-C-HA) |
PV018107 |
ABM |
500 ng |
EUR 329 |
GNLY Protein Vector (Human) (pPM-C-His) |
PV018108 |
ABM |
500 ng |
EUR 329 |
GNLY 3'UTR Luciferase Stable Cell Line |
TU009013 |
ABM |
1.0 ml |
EUR 1394 |
GNLY 3'UTR GFP Stable Cell Line |
TU059013 |
ABM |
1.0 ml |
EUR 1394 |
GNLY ELISA Kit (Human) : 96 Wells (OKEH02758) |
OKEH02758 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
GNLY Rabbit Polyclonal Antibody