EDN2 Rabbit Polyclonal Antibody

EDN2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

EDN2 Polyclonal Antibody

ES11086-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDN2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDN2 Polyclonal Antibody

ES11086-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDN2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Endothelin 2 (EDN2) ELISA Kit

DLR-EDN2-Hu-48T 48T
EUR 463
  • Should the Human Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 2 (EDN2) in samples from serum, plasma or other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

DLR-EDN2-Hu-96T 96T
EUR 599
  • Should the Human Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 2 (EDN2) in samples from serum, plasma or other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

DLR-EDN2-Ra-48T 48T
EUR 495
  • Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

DLR-EDN2-Ra-96T 96T
EUR 644
  • Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

RDR-EDN2-Hu-48Tests 48 Tests
EUR 481

Human Endothelin 2 (EDN2) ELISA Kit

RDR-EDN2-Hu-96Tests 96 Tests
EUR 665

Rat Endothelin 2 (EDN2) ELISA Kit

RDR-EDN2-Ra-48Tests 48 Tests
EUR 519

Rat Endothelin 2 (EDN2) ELISA Kit

RDR-EDN2-Ra-96Tests 96 Tests
EUR 720

Human Endothelin 2 (EDN2) ELISA Kit

RD-EDN2-Hu-48Tests 48 Tests
EUR 460

Human Endothelin 2 (EDN2) ELISA Kit

RD-EDN2-Hu-96Tests 96 Tests
EUR 636

Rat Endothelin 2 (EDN2) ELISA Kit

RD-EDN2-Ra-48Tests 48 Tests
EUR 496

Rat Endothelin 2 (EDN2) ELISA Kit

RD-EDN2-Ra-96Tests 96 Tests
EUR 688

EDN2 antibody

70R-16997 50 ul
EUR 435
Description: Rabbit polyclonal EDN2 antibody

EDN2 Antibody

35734-100ul 100ul
EUR 252

EDN2 Antibody

1-CSB-PA033256
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EDN2 Antibody

1-CSB-PA161267
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

EDN2 Antibody

1-CSB-PA168757
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

EDN2 antibody

70R-9137 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EDN2 antibody

EDN2 Antibody

1-CSB-PA007401GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Endothelin 2 (EDN2) Polyclonal Antibody (Human)

4-PAF415Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2)

EDN2 Conjugated Antibody

C35734 100ul
EUR 397

Anti-EDN2 antibody

STJ192244 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDN2

Edn2/ Rat Edn2 ELISA Kit

ELI-06810r 96 Tests
EUR 886

Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC

4-PAF415Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), Biotinylated

4-PAF415Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Biotin.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), Cy3

4-PAF415Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Cy3.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), FITC

4-PAF415Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with FITC.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), HRP

4-PAF415Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with HRP.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), PE

4-PAF415Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with PE.

Rabbit Endothelin- 2, EDN2 ELISA KIT

ELI-06808Ra 96 Tests
EUR 928

EDN2 siRNA

20-abx901638
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDN2 siRNA

20-abx914960
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDN2 siRNA

20-abx914961
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

abx027651-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

abx027651-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

20-abx176270
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Antibody

20-abx210820
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

20-abx211230
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

20-abx112293
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

20-abx128276
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Endothelin 2 (EDN2) Antibody

20-abx172237
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Antibody

20-abx172238
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Antibody

20-abx339841
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC-Cy7

4-PAF415Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC-Cy7.

EDN2 Blocking Peptide

33R-6611 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDN2 antibody, catalog no. 70R-9137

EDN2 cloning plasmid

CSB-CL007401HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atggtctccgtgcctaccacctggtgctccgttgcgctagccctgctcgtggccctgcatgaagggaagggccaggctgctgccaccctggagcagccagcgtcctcatctcatgcccaaggcacccaccttcggcttcgccgttgctcctgcagctcctggctcgacaaggagtg
  • Show more
Description: A cloning plasmid for the EDN2 gene.

ET-2/EDN2/ Rat ET- 2/ EDN2 ELISA Kit

ELA-E14916r 96 Tests
EUR 886

EDN2 protein (His tag)

80R-2705 100 ug
EUR 322
Description: Purified recombinant EDN2 protein (His tag)

Endothelin 2 (EDN2) Protein

20-abx260088
  • EUR 328.00
  • EUR 2736.00
  • EUR 787.00
  • 1 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human EDN2 ELISA Kit

ELA-E2118h 96 Tests
EUR 824

Canine EDN2 ELISA KIT

ELI-06806d 96 Tests
EUR 928

EDN2 ELISA KIT|Human

EF006192 96 Tests
EUR 689

Rat EDN2 shRNA Plasmid

20-abx984439
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EDN2 shRNA Plasmid

20-abx970107
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EDN2 shRNA Plasmid

20-abx951326
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Endothelin 2 (EDN2)

4-RPF415Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20800
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Endothelin 2 expressed in: E.coli

pCMV-SPORT6-EDN2 Plasmid

PVT16378 2 ug
EUR 325

EDN2 Recombinant Protein (Human)

RP010177 100 ug Ask for price

EDN2 Recombinant Protein (Rat)

RP199061 100 ug Ask for price

EDN2 Recombinant Protein (Mouse)

RP130874 100 ug Ask for price

Human Endothelin 2 (EDN2) Protein

20-abx166607
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Endothelin 2 (EDN2) Protein

20-abx653272
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Edn2 ORF Vector (Rat) (pORF)

ORF066355 1.0 ug DNA
EUR 506

EDN2 ORF Vector (Human) (pORF)

ORF003393 1.0 ug DNA
EUR 95

Edn2 ORF Vector (Mouse) (pORF)

ORF043626 1.0 ug DNA
EUR 506

EDN2 Human Endothelin-2 protein

PROTP20800-1 Regular: 5mg
EUR 697
Description: EDN2 contains 21 amino acids having a molecular mass of 2546.97 Dalton.

EDN2 ELISA Kit (Rat) (OKCD02399)

OKCD02399 96 Wells
EUR 896
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.67 pg/mL

EDN2 ELISA Kit (Mouse) (OKEH01507)

OKEH01507 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the endothelin family of peptides. The encoded preproprotein undergoes proteolytic processing to generate a potent vasoconstrictive peptide. This gene is abundantly expressed in the gastrointestinal tract, strongly induced in photorecepteror cells in retinal diseases and injury, and produced by microglia and macrophages in the early stages of glaucoma. Mice lacking the encoded protein exhibit severe growth retardation, hypothermia and juvenile lethality.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.044 ng/mL

EDN2 ELISA Kit (Rat) (OKEH06451)

OKEH06451 96 Wells
EUR 662
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 42.3 pg/mL

Monoclonal EDN2 Antibody (monoclonal) (M01), Clone: 3B4-1C5

AMM03480G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human EDN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B4-1C5. This antibody is applicable in WB

Human Endothelin 2 (EDN2) ELISA Kit

20-abx156808
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Endothelin 2 (EDN2) ELISA Kit

20-abx155474
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Endothelin 2 (EDN2) ELISA Kit

abx255075-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human EDN2/ Endothelin-2 ELISA Kit

E0758Hu 1 Kit
EUR 571

Mouse Edn2/ Endothelin-2 ELISA Kit

E1635Mo 1 Kit
EUR 571

Human EDN2(Endothelin-2) ELISA Kit

EH2114 96T
EUR 567.6
  • Detection range: 0.781-50 pg/ml
  • Uniprot ID: P20800
  • Alias: ET-2/Preproendothelin-2(PPET2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469pg/ml

Bovine Endothelin- 2, EDN2 ELISA KIT

ELI-06807b 96 Tests
EUR 928

Mouse Endothelin- 2, Edn2 ELISA KIT

ELI-06809m 96 Tests
EUR 865

Human Endothelin- 2, EDN2 ELISA KIT

ELI-06811h 96 Tests
EUR 824

Human Endothelin 2 (EDN2) ELISA Kit

CEF415Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

CEF415Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

CEF415Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

CEF415Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

4-CEF415Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
  • PPET2
  • Preproendothelin-2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin 2 (EDN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Endothelin 2 (EDN2) ELISA Kit

CEF415Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

CEF415Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

CEF415Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

CEF415Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

4-CEF415Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
  • PPET2
  • Preproendothelin-2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Endothelin 2 (EDN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Endothelin-2(EDN2) ELISA kit

CSB-EL007401MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Endothelin-2(EDN2) ELISA kit

1-CSB-EL007401MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Endothelin-2(EDN2)ELISA Kit

CSB-E16518h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Endothelin-2(EDN2)ELISA Kit

1-CSB-E16518h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Endothelin 2 (EDN2) ELISA Kit

abx575853-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Endothelin 2 (EDN2) ELISA Kit

abx576570-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Cow Endothelin 2 (EDN2) ELISA Kit

abx519466-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Endothelin 2 (EDN2) ELISA Kit

abx519467-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Endothelin 2 (EDN2) CLIA Kit

20-abx490518
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Endothelin 2 (EDN2) CLIA Kit

20-abx490519
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Edn2(Endothelin-2) ELISA Kit

EM0727 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P22389
  • Alias: Edn2/ET-2/Preproendothelin-2(PPET2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

EDN2 sgRNA CRISPR Lentivector set (Human)

K0654001 3 x 1.0 ug
EUR 339

Edn2 sgRNA CRISPR Lentivector set (Rat)

K6886201 3 x 1.0 ug
EUR 339

Edn2 sgRNA CRISPR Lentivector set (Mouse)

K3710801 3 x 1.0 ug
EUR 339

ELISA kit for Human EDN2 (Endothelin 2)

ELK5069 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat EDN2 (Endothelin 2)

ELK6274 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

EDN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0654002 1.0 ug DNA
EUR 154

EDN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0654003 1.0 ug DNA
EUR 154

EDN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0654004 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6886202 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6886203 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6886204 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3710802 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3710803 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3710804 1.0 ug DNA
EUR 154

ELISA kit for Human Endothelin-2 (EDN2)

KTE61953-48T 48T
EUR 332
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)

KTE61953-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)

KTE61953-96T 96T
EUR 539
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

EDN2 Protein Vector (Mouse) (pPB-C-His)

PV174502 500 ng
EUR 603

EDN2 Protein Vector (Mouse) (pPB-N-His)

PV174503 500 ng
EUR 603

EDN2 Protein Vector (Mouse) (pPM-C-HA)

PV174504 500 ng
EUR 603

EDN2 Protein Vector (Mouse) (pPM-C-His)

PV174505 500 ng
EUR 603

EDN2 Protein Vector (Rat) (pPB-C-His)

PV265418 500 ng
EUR 603

EDN2 Protein Vector (Rat) (pPB-N-His)

PV265419 500 ng
EUR 603

EDN2 Protein Vector (Rat) (pPM-C-HA)

PV265420 500 ng
EUR 603

EDN2 Protein Vector (Rat) (pPM-C-His)

PV265421 500 ng
EUR 603

EDN2 Protein Vector (Human) (pPB-C-His)

PV013569 500 ng
EUR 329

EDN2 Protein Vector (Human) (pPB-N-His)

PV013570 500 ng
EUR 329

EDN2 Protein Vector (Human) (pPM-C-HA)

PV013571 500 ng
EUR 329

EDN2 Protein Vector (Human) (pPM-C-His)

PV013572 500 ng
EUR 329

Recombinant Human EDN2 Protein, His, E.coli-1mg

QP11746-HIS-1mg 1mg
EUR 2757

Recombinant Human EDN2 Protein, His, E.coli-20ug

QP11746-HIS-20ug 20ug
EUR 201

Recombinant Human EDN2 Protein, His, E.coli-5ug

QP11746-HIS-5ug 5ug
EUR 155

Edn2 3'UTR GFP Stable Cell Line

TU155603 1.0 ml Ask for price

Edn2 3'UTR Luciferase Stable Cell Line

TU105603 1.0 ml Ask for price

Edn2 3'UTR Luciferase Stable Cell Line

TU203781 1.0 ml Ask for price

Edn2 3'UTR GFP Stable Cell Line

TU253781 1.0 ml Ask for price

EDN2 3'UTR GFP Stable Cell Line

TU056565 1.0 ml
EUR 1394

EDN2 3'UTR Luciferase Stable Cell Line

TU006565 1.0 ml
EUR 1394

EDN2 ELISA Kit (Human) : 96 Wells (OKEH00573)

OKEH00573 96 Wells
EUR 662
Description: Description of target: Endothelins are endothelium-derived vasoconstrictor peptides.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

EDN2 Rabbit Polyclonal Antibody