EDN2 Rabbit Polyclonal Antibody

EDN2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

EDN2 Polyclonal Antibody
ABP58455-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EDN2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein

EDN2 Polyclonal Antibody
ABP58455-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EDN2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein

Human Endothelin 2 (EDN2) ELISA Kit
DLR-EDN2-Hu-48T 48T
EUR 463
  • Should the Human Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 2 (EDN2) in samples from serum, plasma or other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
DLR-EDN2-Hu-96T 96T
EUR 599
  • Should the Human Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 2 (EDN2) in samples from serum, plasma or other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
DLR-EDN2-Ra-48T 48T
EUR 495
  • Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
DLR-EDN2-Ra-96T 96T
EUR 644
  • Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
RDR-EDN2-Hu-48Tests 48 Tests
EUR 481

Human Endothelin 2 (EDN2) ELISA Kit
RDR-EDN2-Hu-96Tests 96 Tests
EUR 665

Rat Endothelin 2 (EDN2) ELISA Kit
RDR-EDN2-Ra-48Tests 48 Tests
EUR 519

Rat Endothelin 2 (EDN2) ELISA Kit
RDR-EDN2-Ra-96Tests 96 Tests
EUR 720

Human Endothelin 2 (EDN2) ELISA Kit
RD-EDN2-Hu-48Tests 48 Tests
EUR 460

Human Endothelin 2 (EDN2) ELISA Kit
RD-EDN2-Hu-96Tests 96 Tests
EUR 636

Rat Endothelin 2 (EDN2) ELISA Kit
RD-EDN2-Ra-48Tests 48 Tests
EUR 496

Rat Endothelin 2 (EDN2) ELISA Kit
RD-EDN2-Ra-96Tests 96 Tests
EUR 688

EDN2 antibody
70R-9137 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EDN2 antibody

EDN2 Antibody
35734-100ul 100ul
EUR 252

EDN2 antibody
70R-16997 50 ul
EUR 435
Description: Rabbit polyclonal EDN2 antibody

EDN2 Antibody
1-CSB-PA007401GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

EDN2 Antibody
1-CSB-PA161267
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

EDN2 Antibody
1-CSB-PA168757
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

EDN2 Antibody
1-CSB-PA033256
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Endothelin 2 (EDN2) Polyclonal Antibody (Human)
4-PAF415Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2)

EDN2 Conjugated Antibody
C35734 100ul
EUR 397

Anti-EDN2 antibody
STJ192244 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDN2

Edn2/ Rat Edn2 ELISA Kit
ELI-06810r 96 Tests
EUR 886

Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC
4-PAF415Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), Biotinylated
4-PAF415Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Biotin.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), Cy3
4-PAF415Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Cy3.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), FITC
4-PAF415Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with FITC.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), HRP
4-PAF415Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with HRP.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), PE
4-PAF415Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with PE.

Rabbit Endothelin- 2, EDN2 ELISA KIT
ELI-06808Ra 96 Tests
EUR 928

EDN2 siRNA
20-abx901638
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDN2 siRNA
20-abx914960
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDN2 siRNA
20-abx914961
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx112293
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx128276
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Endothelin 2 (EDN2) Antibody
abx027651-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
abx027651-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx172237
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Antibody
20-abx172238
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Antibody
20-abx176270
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Antibody
20-abx339841
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx210820
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx211230
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC-Cy7
4-PAF415Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC-Cy7.

EDN2 cloning plasmid
CSB-CL007401HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atggtctccgtgcctaccacctggtgctccgttgcgctagccctgctcgtggccctgcatgaagggaagggccaggctgctgccaccctggagcagccagcgtcctcatctcatgcccaaggcacccaccttcggcttcgccgttgctcctgcagctcctggctcgacaaggagtg
  • Show more
Description: A cloning plasmid for the EDN2 gene.

EDN2 Blocking Peptide
33R-6611 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDN2 antibody, catalog no. 70R-9137

ET-2/EDN2/ Rat ET- 2/ EDN2 ELISA Kit
ELA-E14916r 96 Tests
EUR 886

Rat EDN2 shRNA Plasmid
20-abx984439
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EDN2 ELISA Kit
ELA-E2118h 96 Tests
EUR 824

Canine EDN2 ELISA KIT
ELI-06806d 96 Tests
EUR 928

EDN2 ELISA KIT|Human
EF006192 96 Tests
EUR 689

Endothelin 2 (EDN2) Protein
20-abx260088
  • EUR 328.00
  • EUR 2736.00
  • EUR 787.00
  • 1 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human EDN2 shRNA Plasmid
20-abx951326
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EDN2 protein (His tag)
80R-2705 100 ug
EUR 322
Description: Purified recombinant EDN2 protein (His tag)

Mouse EDN2 shRNA Plasmid
20-abx970107
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Endothelin 2 (EDN2)
4-RPF415Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20800
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Endothelin 2 expressed in: E.coli

EDN2 Recombinant Protein (Human)
RP010177 100 ug Ask for price

pCMV-SPORT6-EDN2 Plasmid
PVT16378 2 ug
EUR 325

EDN2 Recombinant Protein (Rat)
RP199061 100 ug Ask for price

EDN2 Recombinant Protein (Mouse)
RP130874 100 ug Ask for price

Rat Endothelin 2 (EDN2) Protein
20-abx653272
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Endothelin 2 (EDN2) Protein
20-abx166607
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EDN2 ORF Vector (Human) (pORF)
ORF003393 1.0 ug DNA
EUR 95

EDN2 Human Endothelin-2 protein
PROTP20800-1 Regular: 5mg
EUR 697
Description: EDN2 contains 21 amino acids having a molecular mass of 2546.97 Dalton.

Edn2 ORF Vector (Rat) (pORF)
ORF066355 1.0 ug DNA
EUR 506

Edn2 ORF Vector (Mouse) (pORF)
ORF043626 1.0 ug DNA
EUR 506

EDN2 ELISA Kit (Rat) (OKCD02399)
OKCD02399 96 Wells
EUR 896
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.67 pg/mL

EDN2 ELISA Kit (Mouse) (OKEH01507)
OKEH01507 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the endothelin family of peptides. The encoded preproprotein undergoes proteolytic processing to generate a potent vasoconstrictive peptide. This gene is abundantly expressed in the gastrointestinal tract, strongly induced in photorecepteror cells in retinal diseases and injury, and produced by microglia and macrophages in the early stages of glaucoma. Mice lacking the encoded protein exhibit severe growth retardation, hypothermia and juvenile lethality.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.044 ng/mL

EDN2 ELISA Kit (Rat) (OKEH06451)
OKEH06451 96 Wells
EUR 662
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 42.3 pg/mL

Monoclonal EDN2 Antibody (monoclonal) (M01), Clone: 3B4-1C5
AMM03480G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human EDN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B4-1C5. This antibody is applicable in WB

Human Endothelin 2 (EDN2) ELISA Kit
CEF415Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
CEF415Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
CEF415Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
CEF415Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
4-CEF415Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
  • PPET2
  • Preproendothelin-2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin 2 (EDN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Endothelin 2 (EDN2) ELISA Kit
CEF415Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
CEF415Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
CEF415Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
CEF415Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
4-CEF415Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
  • PPET2
  • Preproendothelin-2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Endothelin 2 (EDN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Cow Endothelin 2 (EDN2) ELISA Kit
abx519466-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Endothelin 2 (EDN2) ELISA Kit
abx519467-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Endothelin 2 (EDN2) ELISA Kit
abx575853-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Endothelin 2 (EDN2) ELISA Kit
abx576570-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human EDN2/ Endothelin-2 ELISA Kit
E0758Hu 1 Kit
EUR 571

Mouse Edn2/ Endothelin-2 ELISA Kit
E1635Mo 1 Kit
EUR 571

Human EDN2(Endothelin-2) ELISA Kit
EH2114 96T
EUR 567.6
  • Detection range: 0.781-50 pg/ml
  • Uniprot ID: P20800
  • Alias: ET-2/Preproendothelin-2(PPET2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469pg/ml

Bovine Endothelin- 2, EDN2 ELISA KIT
ELI-06807b 96 Tests
EUR 928

Mouse Endothelin- 2, Edn2 ELISA KIT
ELI-06809m 96 Tests
EUR 865

Human Endothelin- 2, EDN2 ELISA KIT
ELI-06811h 96 Tests
EUR 824

Mouse Edn2(Endothelin-2) ELISA Kit
EM0727 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P22389
  • Alias: Edn2/ET-2/Preproendothelin-2(PPET2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

EDN2 sgRNA CRISPR Lentivector set (Human)
K0654001 3 x 1.0 ug
EUR 339

Rat Endothelin 2 (EDN2) ELISA Kit
20-abx155474
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Endothelin 2 (EDN2) ELISA Kit
20-abx156808
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Endothelin 2 (EDN2) CLIA Kit
20-abx490518
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Endothelin 2 (EDN2) CLIA Kit
20-abx490519
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Endothelin 2 (EDN2) ELISA Kit
abx255075-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Edn2 sgRNA CRISPR Lentivector set (Mouse)
K3710801 3 x 1.0 ug
EUR 339

Human Endothelin-2(EDN2)ELISA Kit
CSB-E16518h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Endothelin-2(EDN2)ELISA Kit
1-CSB-E16518h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Endothelin-2(EDN2) ELISA kit
CSB-EL007401MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Endothelin-2(EDN2) ELISA kit
1-CSB-EL007401MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Edn2 sgRNA CRISPR Lentivector set (Rat)
K6886201 3 x 1.0 ug
EUR 339

ELISA kit for Human EDN2 (Endothelin 2)
ELK5069 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat EDN2 (Endothelin 2)
ELK6274 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

EDN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0654002 1.0 ug DNA
EUR 154

EDN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0654003 1.0 ug DNA
EUR 154

EDN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0654004 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3710802 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3710803 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3710804 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6886202 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6886203 1.0 ug DNA
EUR 154

Edn2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6886204 1.0 ug DNA
EUR 154

ELISA kit for Human Endothelin-2 (EDN2)
KTE61953-48T 48T
EUR 332
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)
KTE61953-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)
KTE61953-96T 96T
EUR 539
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

EDN2 Protein Vector (Mouse) (pPB-C-His)
PV174502 500 ng
EUR 603

EDN2 Protein Vector (Mouse) (pPB-N-His)
PV174503 500 ng
EUR 603

EDN2 Protein Vector (Mouse) (pPM-C-HA)
PV174504 500 ng
EUR 603

EDN2 Protein Vector (Mouse) (pPM-C-His)
PV174505 500 ng
EUR 603

Recombinant Human EDN2 Protein, His, E.coli-1mg
QP11746-HIS-1mg 1mg
EUR 2757

Recombinant Human EDN2 Protein, His, E.coli-20ug
QP11746-HIS-20ug 20ug
EUR 201

Recombinant Human EDN2 Protein, His, E.coli-5ug
QP11746-HIS-5ug 5ug
EUR 155

EDN2 Protein Vector (Human) (pPB-C-His)
PV013569 500 ng
EUR 329

EDN2 Protein Vector (Human) (pPB-N-His)
PV013570 500 ng
EUR 329

EDN2 Protein Vector (Human) (pPM-C-HA)
PV013571 500 ng
EUR 329

EDN2 Protein Vector (Human) (pPM-C-His)
PV013572 500 ng
EUR 329

EDN2 Protein Vector (Rat) (pPB-C-His)
PV265418 500 ng
EUR 603

EDN2 Protein Vector (Rat) (pPB-N-His)
PV265419 500 ng
EUR 603

EDN2 Protein Vector (Rat) (pPM-C-HA)
PV265420 500 ng
EUR 603

EDN2 Protein Vector (Rat) (pPM-C-His)
PV265421 500 ng
EUR 603

Edn2 3'UTR Luciferase Stable Cell Line
TU203781 1.0 ml Ask for price

Edn2 3'UTR GFP Stable Cell Line
TU155603 1.0 ml Ask for price

EDN2 3'UTR Luciferase Stable Cell Line
TU006565 1.0 ml
EUR 1394

Edn2 3'UTR Luciferase Stable Cell Line
TU105603 1.0 ml Ask for price

EDN2 3'UTR GFP Stable Cell Line
TU056565 1.0 ml
EUR 1394

Edn2 3'UTR GFP Stable Cell Line
TU253781 1.0 ml Ask for price

EDN2 ELISA Kit (Human) : 96 Wells (OKEH00573)
OKEH00573 96 Wells
EUR 662
Description: Description of target: Endothelins are endothelium-derived vasoconstrictor peptides.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

EDN2 Rabbit Polyclonal Antibody

Apex Business WordPress Theme | Designed by Crafthemes