PDYN Rabbit Polyclonal Antibody
PDYN Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
 PDYN Polyclonal Antibody |
|
ES11431-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PDYN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
PDYN Polyclonal Antibody |
|
ABP59873-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250 |
|
PDYN Polyclonal Antibody |
|
ABP59873-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250 |
|
PDYN Polyclonal Antibody |
|
ABP59873-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250 |
|
PDYN Polyclonal Antibody |
|
30667-100ul |
SAB |
100ul |
EUR 252 |
|
PDYN Polyclonal Antibody |
|
30667-50ul |
SAB |
50ul |
EUR 187 |
 PDYN Rabbit pAb |
|
A5830-100ul |
Abclonal |
100 ul |
EUR 308 |
|
PDYN Rabbit pAb |
|
A5830-200ul |
Abclonal |
200 ul |
EUR 459 |
|
PDYN Rabbit pAb |
|
A5830-20ul |
Abclonal |
20 ul |
EUR 183 |
|
PDYN Rabbit pAb |
|
A5830-50ul |
Abclonal |
50 ul |
EUR 223 |
 PDYN Polyclonal Conjugated Antibody |
|
C30667 |
SAB |
100ul |
EUR 397 |
 Pdyn antibody |
|
70R-9818 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal Pdyn antibody |
 PDYN antibody |
|
23050-100ul |
SAB |
100ul |
EUR 390 |
|
PDYN antibody |
|
70R-13546 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal PDYN antibody |
 Antibody) Prodynorphin (PDYN) Antibody |
|
20-abx142135 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
|
Prodynorphin (PDYN) Antibody |
|
20-abx006315 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
|
Prodynorphin (PDYN) Antibody |
|
abx412427-01ml |
Abbexa |
0.1 ml |
EUR 578 |
|
|
 Anti-PDYN antibody |
|
STJ28393 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a preproprotein that is proteolytically processed to form the secreted opioid peptides beta-neoendorphin, dynorphin, leu-enkephalin, rimorphin, and leumorphin. These peptides are ligands for the kappa-type of opioid receptor. Dynorphin is involved in modulating responses to several psychoactive substances, including cocaine. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. |
|
Anti-PDYN antibody |
|
STJ192589 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PDYN |
 ELISA kit) Rabbit Proenkephalin B(PDYN) ELISA kit |
|
E04P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rabbit Proenkephalin B(PDYN) ELISA kit |
|
E04P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rabbit Proenkephalin B(PDYN) ELISA kit |
|
E04P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 PDYN cloning plasmid |
|
CSB-CL017750HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 765
- Sequence: atggcctggcaggggctggtcctggctgcctgcctcctcatgttcccctccaccacagcggactgcctgtcgcggtgctccttgtgtgctgtaaagacccaggatggtcccaaacctatcaatcccctgatttgctccctgcaatgccaggctgccctgctgccctctgaggaatg
- Show more
|
|
Description: A cloning plasmid for the PDYN gene. |
 Pdyn Blocking Peptide |
|
33R-9191 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pdyn antibody, catalog no. 70R-9818 |
 Antibody) Dynorphin A (Dyn1-17/PDYN) Antibody |
|
abx412425-01ml |
Abbexa |
0.1 ml |
EUR 578 |
|
|
 Antibody) Dynorphin B (Dyn1-13/PDYN) Antibody |
|
abx412426-01ml |
Abbexa |
0.1 ml |
EUR 578 |
|
|
 Human PDYN shRNA Plasmid |
|
20-abx953452 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PDYN Recombinant Protein (Human) |
|
RP023017 |
ABM |
100 ug |
Ask for price |
) PDYN Recombinant Protein (Rat) |
|
RP219965 |
ABM |
100 ug |
Ask for price |
) PDYN Recombinant Protein (Mouse) |
|
RP161207 |
ABM |
100 ug |
Ask for price |
 (pORF)) PDYN ORF Vector (Human) (pORF) |
|
ORF007673 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Pdyn ORF Vector (Rat) (pORF) |
|
ORF073323 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Pdyn ORF Vector (Mouse) (pORF) |
|
ORF053737 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKEH03583)) PDYN ELISA Kit (Rat) (OKEH03583) |
|
OKEH03583 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
|
Description: Description of target: Leu-enkephalins compete with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress. Dynorphin peptides differentially regulate the kappa opioid receptor. Dynorphin A(1-13) has a typical opiod activity, it is 700 times more potent than Leu-enkephalin. Leumorphin has a typical opiod activity and may have anti-apoptotic effect.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL |
 (OKEH07559)) PDYN ELISA Kit (Bovine) (OKEH07559) |
|
OKEH07559 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
|
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
 (OKEH07560)) PDYN ELISA Kit (Pig) (OKEH07560) |
|
OKEH07560 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
|
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
 ELISA Kit) Cow Proenkephalin-B (PDYN) ELISA Kit |
|
abx514688-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Proenkephalin-B (PDYN) ELISA Kit |
|
abx514690-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Proenkephalin-B (PDYN) ELISA Kit |
|
abx514691-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA kit) Rat Proenkephalin B(PDYN) ELISA kit |
|
E02P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Proenkephalin B(PDYN) ELISA kit |
|
E02P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Proenkephalin B(PDYN) ELISA kit |
|
E02P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
PDYN Rabbit Polyclonal Antibody
Pdyn/ Rat Pdyn ELISA Kit 
Human PDYN ELISA Kit 
PDYN ELISA KIT|Human ELISA Kit)
Human Prodynorphin(PDYN)ELISA Kit