PARP9 Rabbit Polyclonal Antibody

PARP9 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PARP9 Polyclonal Antibody
ES11274-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PARP9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PARP9 Polyclonal Antibody
ABP59835-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of PARP9 from Human, Mouse. This PARP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
PARP9 Polyclonal Antibody
ABP59835-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of PARP9 from Human, Mouse. This PARP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
PARP9 Polyclonal Antibody
ABP59835-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of PARP9 from Human, Mouse. This PARP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
PARP9 Polyclonal Antibody
29322-100ul 100ul
EUR 252
PARP9 Polyclonal Antibody
29322-50ul 50ul
EUR 187
PARP9 Rabbit pAb
A15526-100ul 100 ul
EUR 308
PARP9 Rabbit pAb
A15526-200ul 200 ul
EUR 459
PARP9 Rabbit pAb
A15526-20ul 20 ul
EUR 183
PARP9 Rabbit pAb
A15526-50ul 50 ul
EUR 223
PARP9 Polyclonal Conjugated Antibody
C29322 100ul
EUR 397
PARP9 antibody
70R-2874 50 ug
EUR 467
Description: Rabbit polyclonal PARP9 antibody
PARP9 antibody
70R-19121 50 ul
EUR 435
Description: Rabbit polyclonal PARP9 antibody
PARP9 Antibody
1-CSB-PA017472GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PARP9. Recognizes PARP9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Polyclonal Parp9 Antibody (C-term)
APR03594G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Parp9 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal PARP9 antibody - N-terminal region
APR08944G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARP9 - N-terminal region. This antibody is tested and proven to work in the following applications:
anti- PARP9 antibody
FNab06160 100µg
EUR 505.25
  • Immunogen: poly(ADP-ribose) polymerase family, member 9
  • Uniprot ID: Q8IXQ6
  • Gene ID: 83666
  • Research Area: Metabolism
Description: Antibody raised against PARP9
Anti-PARP9 antibody
PAab06160 100 ug
EUR 355
Anti-PARP9 antibody
STJ117721 100 µl
EUR 277
Anti-PARP9 antibody
STJ192432 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PARP9
PARP9 siRNA
20-abx927770
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PARP9 siRNA
20-abx927771
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PARP9 Blocking Peptide
33R-5013 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP9 antibody, catalog no. 70R-2874
PARP9 cloning plasmid
CSB-CL815575HU-10ug 10ug
EUR 798
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2460
  • Sequence: atggacttttccatggtggccggagcagcagcttacaatgaaaaatcagagactggtgctcttggagaaaactatagttggcaaattcccattaaccacaatgacttcaaaattttaaaaaataatgagcgtcagctgtgtgaagtcctccagaataagtttggctgtatctcta
  • Show more
Description: A cloning plasmid for the PARP9 gene.
Mouse PARP9 shRNA Plasmid
20-abx979015
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PARP9 shRNA Plasmid
20-abx963159
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PARP9 ELISA KIT|Human
EF001569 96 Tests
EUR 689
PARP9 Recombinant Protein (Human)
RP022600 100 ug Ask for price
PARP9 Recombinant Protein (Rat)
RP219350 100 ug Ask for price
PARP9 Recombinant Protein (Mouse)
RP160208 100 ug Ask for price
Poly ADP Ribose Polymerase 9 (PARP9) Antibody
abx236160-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
PARP9 ORF Vector (Human) (pORF)
ORF007534 1.0 ug DNA
EUR 95
Parp9 ORF Vector (Rat) (pORF)
ORF073118 1.0 ug DNA
EUR 506
Parp9 ORF Vector (Mouse) (pORF)
ORF053404 1.0 ug DNA
EUR 506
PARP9 sgRNA CRISPR Lentivector set (Human)
K1596201 3 x 1.0 ug
EUR 339
Parp9 sgRNA CRISPR Lentivector set (Rat)
K7276301 3 x 1.0 ug
EUR 339
Parp9 sgRNA CRISPR Lentivector set (Mouse)
K4903901 3 x 1.0 ug
EUR 339
PARP9 sgRNA CRISPR Lentivector (Human) (Target 1)
K1596202 1.0 ug DNA
EUR 154
PARP9 sgRNA CRISPR Lentivector (Human) (Target 2)
K1596203 1.0 ug DNA
EUR 154
PARP9 sgRNA CRISPR Lentivector (Human) (Target 3)
K1596204 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7276302 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7276303 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7276304 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4903902 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4903903 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4903904 1.0 ug DNA
EUR 154
PARP9 Protein Vector (Human) (pPB-C-His)
PV030133 500 ng
EUR 329
PARP9 Protein Vector (Human) (pPB-N-His)
PV030134 500 ng
EUR 329
PARP9 Protein Vector (Human) (pPM-C-HA)
PV030135 500 ng
EUR 329
PARP9 Protein Vector (Human) (pPM-C-His)
PV030136 500 ng
EUR 329
PARP9 Protein Vector (Mouse) (pPB-C-His)
PV213614 500 ng
EUR 1065
PARP9 Protein Vector (Mouse) (pPB-N-His)
PV213615 500 ng
EUR 1065
PARP9 Protein Vector (Mouse) (pPM-C-HA)
PV213616 500 ng
EUR 1065
PARP9 Protein Vector (Mouse) (pPM-C-His)
PV213617 500 ng
EUR 1065
PARP9 Protein Vector (Rat) (pPB-C-His)
PV292470 500 ng
EUR 1166
PARP9 Protein Vector (Rat) (pPB-N-His)
PV292471 500 ng
EUR 1166
PARP9 Protein Vector (Rat) (pPM-C-HA)
PV292472 500 ng
EUR 1166
PARP9 Protein Vector (Rat) (pPM-C-His)
PV292473 500 ng
EUR 1166
Parp9 3'UTR GFP Stable Cell Line
TU165926 1.0 ml Ask for price
PARP9 3'UTR Luciferase Stable Cell Line
TU017415 1.0 ml
EUR 2333
Parp9 3'UTR Luciferase Stable Cell Line
TU115926 1.0 ml Ask for price
PARP9 3'UTR GFP Stable Cell Line
TU067415 1.0 ml
EUR 2333
Parp9 3'UTR GFP Stable Cell Line
TU265829 1.0 ml Ask for price
Parp9 3'UTR Luciferase Stable Cell Line
TU215829 1.0 ml Ask for price
PARP9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV631483 1.0 ug DNA
EUR 1355
PARP9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV631487 1.0 ug DNA
EUR 1355
PARP9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV631488 1.0 ug DNA
EUR 1355
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PARP9 Rabbit Polyclonal Antibody