PARP9 Rabbit Polyclonal Antibody

PARP9 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PARP9 Polyclonal Antibody
29322-50ul 50ul
EUR 187
PARP9 Polyclonal Antibody
ABP59835-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of PARP9 from Human, Mouse. This PARP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
PARP9 Polyclonal Antibody
ABP59835-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of PARP9 from Human, Mouse. This PARP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
PARP9 Polyclonal Antibody
ABP59835-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of PARP9 from Human, Mouse. This PARP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
PARP9 Polyclonal Antibody
ES11274-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PARP9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PARP9 Polyclonal Antibody
ES11274-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PARP9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PARP9 Rabbit pAb
A15526-100ul 100 ul
EUR 308
PARP9 Rabbit pAb
A15526-200ul 200 ul
EUR 459
PARP9 Rabbit pAb
A15526-20ul 20 ul
EUR 183
PARP9 Rabbit pAb
A15526-50ul 50 ul
EUR 223
PARP9 Polyclonal Conjugated Antibody
C29322 100ul
EUR 397
PARP9 antibody
70R-19121 50 ul
EUR 435
Description: Rabbit polyclonal PARP9 antibody
PARP9 antibody
70R-2874 50 ug
EUR 467
Description: Rabbit polyclonal PARP9 antibody
PARP9 Antibody
1-CSB-PA017472GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PARP9. Recognizes PARP9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Polyclonal Parp9 Antibody (C-term)
APR03594G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Parp9 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal PARP9 antibody - N-terminal region
APR08944G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARP9 - N-terminal region. This antibody is tested and proven to work in the following applications:
anti- PARP9 antibody
FNab06160 100µg
EUR 505.25
  • Immunogen: poly(ADP-ribose) polymerase family, member 9
  • Uniprot ID: Q8IXQ6
  • Gene ID: 83666
  • Research Area: Metabolism
Description: Antibody raised against PARP9
Anti-PARP9 antibody
PAab06160 100 ug
EUR 355
Anti-PARP9 antibody
STJ117721 100 µl
EUR 277
Anti-PARP9 antibody
STJ192432 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PARP9
PARP9 siRNA
20-abx927770
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PARP9 siRNA
20-abx927771
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PARP9 Blocking Peptide
33R-5013 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP9 antibody, catalog no. 70R-2874
PARP9 cloning plasmid
CSB-CL815575HU-10ug 10ug
EUR 798
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2460
  • Sequence: atggacttttccatggtggccggagcagcagcttacaatgaaaaatcagagactggtgctcttggagaaaactatagttggcaaattcccattaaccacaatgacttcaaaattttaaaaaataatgagcgtcagctgtgtgaagtcctccagaataagtttggctgtatctcta
  • Show more
Description: A cloning plasmid for the PARP9 gene.
PARP9 ELISA KIT|Human
EF001569 96 Tests
EUR 689
Mouse PARP9 shRNA Plasmid
20-abx979015
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PARP9 shRNA Plasmid
20-abx963159
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PARP9 Recombinant Protein (Human)
RP022600 100 ug Ask for price
PARP9 Recombinant Protein (Mouse)
RP160208 100 ug Ask for price
PARP9 Recombinant Protein (Rat)
RP219350 100 ug Ask for price
Poly ADP Ribose Polymerase 9 (PARP9) Antibody
abx236160-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Parp9 ORF Vector (Rat) (pORF)
ORF073118 1.0 ug DNA
EUR 506
PARP9 ORF Vector (Human) (pORF)
ORF007534 1.0 ug DNA
EUR 95
Parp9 ORF Vector (Mouse) (pORF)
ORF053404 1.0 ug DNA
EUR 506
Parp9 sgRNA CRISPR Lentivector set (Mouse)
K4903901 3 x 1.0 ug
EUR 339
Parp9 sgRNA CRISPR Lentivector set (Rat)
K7276301 3 x 1.0 ug
EUR 339
PARP9 sgRNA CRISPR Lentivector set (Human)
K1596201 3 x 1.0 ug
EUR 339
Parp9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4903902 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4903903 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4903904 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7276302 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7276303 1.0 ug DNA
EUR 154
Parp9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7276304 1.0 ug DNA
EUR 154
PARP9 sgRNA CRISPR Lentivector (Human) (Target 1)
K1596202 1.0 ug DNA
EUR 154
PARP9 sgRNA CRISPR Lentivector (Human) (Target 2)
K1596203 1.0 ug DNA
EUR 154
PARP9 sgRNA CRISPR Lentivector (Human) (Target 3)
K1596204 1.0 ug DNA
EUR 154
PARP9 Protein Vector (Rat) (pPB-C-His)
PV292470 500 ng
EUR 1166
PARP9 Protein Vector (Rat) (pPB-N-His)
PV292471 500 ng
EUR 1166
PARP9 Protein Vector (Rat) (pPM-C-HA)
PV292472 500 ng
EUR 1166
PARP9 Protein Vector (Rat) (pPM-C-His)
PV292473 500 ng
EUR 1166
PARP9 Protein Vector (Mouse) (pPB-C-His)
PV213614 500 ng
EUR 1065
PARP9 Protein Vector (Mouse) (pPB-N-His)
PV213615 500 ng
EUR 1065
PARP9 Protein Vector (Mouse) (pPM-C-HA)
PV213616 500 ng
EUR 1065
PARP9 Protein Vector (Mouse) (pPM-C-His)
PV213617 500 ng
EUR 1065
PARP9 Protein Vector (Human) (pPB-C-His)
PV030133 500 ng
EUR 329
PARP9 Protein Vector (Human) (pPB-N-His)
PV030134 500 ng
EUR 329
PARP9 Protein Vector (Human) (pPM-C-HA)
PV030135 500 ng
EUR 329
PARP9 Protein Vector (Human) (pPM-C-His)
PV030136 500 ng
EUR 329
Parp9 3'UTR Luciferase Stable Cell Line
TU115926 1.0 ml Ask for price
Parp9 3'UTR GFP Stable Cell Line
TU165926 1.0 ml Ask for price
Parp9 3'UTR Luciferase Stable Cell Line
TU215829 1.0 ml Ask for price
Parp9 3'UTR GFP Stable Cell Line
TU265829 1.0 ml Ask for price
PARP9 3'UTR GFP Stable Cell Line
TU067415 1.0 ml
EUR 2333
PARP9 3'UTR Luciferase Stable Cell Line
TU017415 1.0 ml
EUR 2333
PARP9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV631483 1.0 ug DNA
EUR 1355
PARP9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV631487 1.0 ug DNA
EUR 1355
PARP9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV631488 1.0 ug DNA
EUR 1355
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

PARP9 Rabbit Polyclonal Antibody