FLRT2 Rabbit Polyclonal Antibody

FLRT2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FLRT2 Polyclonal Antibody
30115-50ul 50ul
EUR 187
FLRT2 Polyclonal Antibody
ABP58572-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
FLRT2 Polyclonal Antibody
ABP58572-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
FLRT2 Polyclonal Antibody
ABP58572-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
FLRT2 Polyclonal Antibody
ES11281-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FLRT2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
FLRT2 Polyclonal Antibody
ES11281-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FLRT2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
FLRT2 Rabbit pAb
A17668-100ul 100 ul
EUR 308
FLRT2 Rabbit pAb
A17668-200ul 200 ul
EUR 459
FLRT2 Rabbit pAb
A17668-20ul 20 ul
EUR 183
FLRT2 Rabbit pAb
A17668-50ul 50 ul
EUR 223
FLRT2 Polyclonal Conjugated Antibody
C30115 100ul
EUR 397
Rabbit FLRT2 ELISA Kit
ERTF0109 96Tests
EUR 521
Anti-FLRT2 antibody
STJ119717 100 µl
EUR 277
Description: This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Anti-FLRT2 antibody
STJ192439 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FLRT2
FLRT2 siRNA
20-abx916977
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FLRT2 cloning plasmid
CSB-CL008730HU-10ug 10ug
EUR 665
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1983
  • Sequence: atgggcctacagaccacaaagtggcccagccatggggcttttttcctgaagtcttggcttatcatttccctggggctctactcacaggtgtccaaactcctggcctgccctagtgtgtgccgctgcgacaggaactttgtctactgtaatgagcgaagcttgacctcagtgcctc
  • Show more
Description: A cloning plasmid for the FLRT2 gene.
Human FLRT2 ELISA Kit
EHF0109 96Tests
EUR 521
Goat FLRT2 ELISA Kit
EGTF0109 96Tests
EUR 521
Bovine FLRT2 ELISA Kit
EBF0109 96Tests
EUR 521
Canine FLRT2 ELISA Kit
ECF0109 96Tests
EUR 521
Anserini FLRT2 ELISA Kit
EAF0109 96Tests
EUR 521
Human FLRT2 ELISA KIT
ELI-09849h 96 Tests
EUR 824
Human FLRT2 shRNA Plasmid
20-abx958456
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse FLRT2 ELISA Kit
EMF0109 96Tests
EUR 521
Rat FLRT2 ELISA Kit
ERF0109 96Tests
EUR 521
Porcine FLRT2 ELISA Kit
EPF0109 96Tests
EUR 521
FLRT2 Recombinant Protein (Human)
RP039232 100 ug Ask for price
FLRT2 Recombinant Protein (Rat)
RP201539 100 ug Ask for price
FLRT2 Recombinant Protein (Mouse)
RP134801 100 ug Ask for price
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human)
4-PAC481Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2)
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC
4-PAC481Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC.
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Biotinylated
4-PAC481Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Biotin.
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Cy3
4-PAC481Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Cy3.
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), FITC
4-PAC481Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with FITC.
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), HRP
4-PAC481Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with HRP.
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), PE
4-PAC481Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with PE.
Human FLRT2 PicoKine ELISA Kit
EK1971 96 wells
EUR 425
Description: For quantitative detection of human FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA).
Mouse FLRT2 PicoKine ELISA Kit
EK1972 96 wells
EUR 425
Description: For quantitative detection of mouse FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA).
Rat FLRT2 PicoKine ELISA Kit
EK1973 96 wells
EUR 425
Description: For quantitative detection of rat FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA).
Guinea Pig FLRT2 ELISA Kit
EGF0109 96Tests
EUR 521
Flrt2 ORF Vector (Rat) (pORF)
ORF067181 1.0 ug DNA
EUR 506
FLRT2 ORF Vector (Human) (pORF)
ORF013078 1.0 ug DNA
EUR 354
Flrt2 ORF Vector (Mouse) (pORF)
ORF044935 1.0 ug DNA
EUR 506
FLRT2 ELISA Kit (Human) (OKBB01345)
OKBB01345 96 Wells
EUR 505
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 14q31.3. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
Flrt2 ELISA Kit (Mouse) (OKBB01346)
OKBB01346 96 Wells
EUR 505
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 12; 12 E. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
Flrt2 ELISA Kit (Rat) (OKBB01347)
OKBB01347 96 Wells
EUR 505
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 6q31. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
FLRT2 ELISA Kit (Human) (OKCA01329)
OKCA01329 96 Wells
EUR 846
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells. May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D. Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members. Plays a role in fibroblast growth factor-mediated signaling cascades. Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 23.44 pg/mL
FLRT2 ELISA Kit (Mouse) (OKEI00453)
OKEI00453 96 Wells
EUR 767
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells . May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D . Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members . Plays a role in fibroblast growth factor-mediated signaling cascades . Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis .;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.875 ng/mL
FLRT2 ELISA Kit (Rat) (OKEI00767)
OKEI00767 96 Wells
EUR 767
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells. May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D. Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members. Plays a role in fibroblast growth factor-mediated signaling cascades. Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL
Rabbit Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) ELISA Kit
abx362800-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC-Cy7
4-PAC481Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC-Cy7.
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Antibody
20-abx131259
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Flrt2 sgRNA CRISPR Lentivector set (Rat)
K6636201 3 x 1.0 ug
EUR 339
FLRT2 sgRNA CRISPR Lentivector set (Human)
K0787901 3 x 1.0 ug
EUR 339
Flrt2 sgRNA CRISPR Lentivector set (Mouse)
K4147701 3 x 1.0 ug
EUR 339
Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6636202 1.0 ug DNA
EUR 154
Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6636203 1.0 ug DNA
EUR 154
Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6636204 1.0 ug DNA
EUR 154
FLRT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0787902 1.0 ug DNA
EUR 154
FLRT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0787903 1.0 ug DNA
EUR 154
FLRT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0787904 1.0 ug DNA
EUR 154
Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4147702 1.0 ug DNA
EUR 154
Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4147703 1.0 ug DNA
EUR 154
Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4147704 1.0 ug DNA
EUR 154
FLRT2 Protein Vector (Mouse) (pPB-C-His)
PV179738 500 ng
EUR 603
FLRT2 Protein Vector (Mouse) (pPB-N-His)
PV179739 500 ng
EUR 603
FLRT2 Protein Vector (Mouse) (pPM-C-HA)
PV179740 500 ng
EUR 603
FLRT2 Protein Vector (Mouse) (pPM-C-His)
PV179741 500 ng
EUR 603
FLRT2 Protein Vector (Rat) (pPB-C-His)
PV268722 500 ng
EUR 603
FLRT2 Protein Vector (Rat) (pPB-N-His)
PV268723 500 ng
EUR 603
FLRT2 Protein Vector (Rat) (pPM-C-HA)
PV268724 500 ng
EUR 603
FLRT2 Protein Vector (Rat) (pPM-C-His)
PV268725 500 ng
EUR 603
FLRT2 Protein Vector (Human) (pPB-C-His)
PV052309 500 ng
EUR 481
FLRT2 Protein Vector (Human) (pPB-N-His)
PV052310 500 ng
EUR 481
FLRT2 Protein Vector (Human) (pPM-C-HA)
PV052311 500 ng
EUR 481
FLRT2 Protein Vector (Human) (pPM-C-His)
PV052312 500 ng
EUR 481
Flrt2 3'UTR GFP Stable Cell Line
TU156621 1.0 ml Ask for price
Flrt2 3'UTR Luciferase Stable Cell Line
TU106621 1.0 ml Ask for price
Flrt2 3'UTR Luciferase Stable Cell Line
TU204683 1.0 ml Ask for price
Flrt2 3'UTR GFP Stable Cell Line
TU254683 1.0 ml Ask for price
FLRT2 3'UTR GFP Stable Cell Line
TU058026 1.0 ml
EUR 2333
FLRT2 3'UTR Luciferase Stable Cell Line
TU008026 1.0 ml
EUR 2333
FLRT2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV649033 1.0 ug DNA
EUR 682
FLRT2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV649037 1.0 ug DNA
EUR 682
FLRT2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV649038 1.0 ug DNA
EUR 682
Recombinant human Leucine-rich repeat transmembrane protein FLRT2
P1409 100ug Ask for price
  • Uniprot ID: O43155
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Leucine-rich repeat transmembrane protein FLRT2
Recombinant Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2)
4-RPC481Hu01
  • EUR 352.67
  • EUR 197.00
  • EUR 1047.52
  • EUR 415.84
  • EUR 731.68
  • EUR 299.00
  • EUR 2468.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43155
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibronectin Leucine Rich Transmembrane Protein 2 expressed in: E.coli
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

FLRT2 Rabbit Polyclonal Antibody