OLIG3 Rabbit Polyclonal Antibody

OLIG3 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

OLIG3 Polyclonal Antibody
28320-50ul 50ul
EUR 187
OLIG3 Polyclonal Antibody
ABP59643-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein
OLIG3 Polyclonal Antibody
ABP59643-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein
OLIG3 Polyclonal Antibody
ABP59643-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein
OLIG3 Polyclonal Antibody
ES10942-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against OLIG3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
OLIG3 Polyclonal Antibody
ES10942-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OLIG3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
OLIG3 Rabbit pAb
A13715-100ul 100 ul
EUR 308
OLIG3 Rabbit pAb
A13715-200ul 200 ul
EUR 459
OLIG3 Rabbit pAb
A13715-20ul 20 ul
EUR 183
OLIG3 Rabbit pAb
A13715-50ul 50 ul
EUR 223
Polyclonal OLIG3 Antibody (Center)
AMM06898G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLIG3 (Center). This antibody is tested and proven to work in the following applications:
OLIG3 Polyclonal Conjugated Antibody
C28320 100ul
EUR 397
OLIG3 antibody
70R-8453 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal OLIG3 antibody
OLIG3 Antibody
abx146016-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Polyclonal OLIG3 Antibody (N-term)
AMM06899G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLIG3 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal Mouse Olig3 Antibody (Center)
AMM06455G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Olig3 (Center). This antibody is tested and proven to work in the following applications:
Anti-OLIG3 antibody
STJ115669 100 µl
EUR 277
Anti-OLIG3 antibody
STJ192100 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OLIG3
OLIG3 siRNA
20-abx926918
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
OLIG3 siRNA
20-abx926919
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-Olig3
YF-PA22609 50 ul
EUR 363
Description: Mouse polyclonal to Olig3
anti-Olig3
YF-PA22610 50 ug
EUR 363
Description: Mouse polyclonal to Olig3
OLIG3 Blocking Peptide
33R-6266 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OLIG3 antibody, catalog no. 70R-8453
OLIG3 cloning plasmid
CSB-CL016330HU-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgaattctgattcgagctctgtctccagcagagcttcatctccggacatggatgagatgtacctgagggaccaccaccaccgccaccaccaccaccaggagagccgtctcaactcggtctcgtccacgcagggcgatatgatgcagaagatgcccggggaaagcctctcgcgggc
  • Show more
Description: A cloning plasmid for the OLIG3 gene.
Human OLIG3 shRNA Plasmid
20-abx966062
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OLIG3 Rabbit Polyclonal Antibody