VAMP1 Rabbit Polyclonal Antibody

VAMP1 Rabbit Polyclonal Antibody

To Order Now:

VAMP1 Polyclonal Antibody

ABP60868-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of VAMP1 from Human, Mouse, Rat. This VAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110

VAMP1 Polyclonal Antibody

ABP60868-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of VAMP1 from Human, Mouse, Rat. This VAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110

VAMP1 Polyclonal Antibody

ES11207-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VAMP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VAMP1 Polyclonal Antibody

ES11207-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VAMP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VAMP1 Rabbit pAb

A8877-100ul 100 ul
EUR 308

VAMP1 Rabbit pAb

A8877-200ul 200 ul
EUR 459

VAMP1 Rabbit pAb

A8877-20ul 20 ul
EUR 183

VAMP1 Rabbit pAb

A8877-50ul 50 ul
EUR 223

VAMP1 antibody

70R-21229 50 ul
EUR 435
Description: Rabbit polyclonal VAMP1 antibody

VAMP1 Antibody

49966-100ul 100ul
EUR 333

VAMP1 Antibody

49966-50ul 50ul
EUR 239

VAMP1 Antibody

40289-100ul 100ul
EUR 252

VAMP1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

VAMP1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

VAMP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

VAMP1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Vamp1 antibody

70R-9793 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Vamp1 antibody

Vamp1 antibody

70R-9794 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Vamp1 antibody

Polyclonal Vamp1 antibody - middle region

APR13934G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vamp1 - middle region. This antibody is tested and proven to work in the following applications:

VAMP1 Polyclonal Antibody, HRP Conjugated

A63777 100 µg
EUR 570.55
Description: kits suitable for this type of research

VAMP1 Polyclonal Antibody, FITC Conjugated

A63778 100 µg
EUR 570.55
Description: fast delivery possible

VAMP1 Polyclonal Antibody, Biotin Conjugated

A63779 100 µg
EUR 570.55
Description: reagents widely cited

Human VAMP1 Antibody

32869-05111 150 ug
EUR 261

VAMP1/2 antibody

10R-8383 100 ul
EUR 392
Description: Mouse monoclonal VAMP1/2 antibody

VAMP1 Conjugated Antibody

C49966 100ul
EUR 397

VAMP1 Conjugated Antibody

C40289 100ul
EUR 397

anti- VAMP1 antibody

FNab09358 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IF: 1:20-1:200
  • Immunogen: vesicle-associated membrane protein 1(synaptobrevin 1)
  • Uniprot ID: P23763
  • Gene ID: 6843
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against VAMP1

Anti-VAMP1 antibody

PAab09358 100 ug
EUR 386

Anti-VAMP1 antibody

STJ111459 100 µl
EUR 277
Description: Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined.

Anti-VAMP1 antibody

STJ192365 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VAMP1

Vamp1/ Rat Vamp1 ELISA Kit

ELI-44656r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VAMP1/VAMP2/VAMP3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VAMP1/VAMP2/VAMP3. Recognizes VAMP1/VAMP2/VAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

VAMP1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VAMP1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VAMP1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VAMP1 / VAMP2 / VAMP3 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vamp1 Blocking Peptide

33R-2033 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Vamp1 antibody, catalog no. 70R-9793

Vamp1 Blocking Peptide

33R-2531 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Vamp1 antibody, catalog no. 70R-9794

VAMP1 cloning plasmid

CSB-CL025780HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 354
  • Sequence: atgtctgctccagctcagccacctgctgaagggacagaagggactgccccaggtgggggtccccctggccctcctcctaacatgaccagtaacagacgactacagcaaacccaggcacaagtggaggaggtggtggacatcatacgtgtgaacgtggacaaggtcctggagaggga
  • Show more
Description: A cloning plasmid for the VAMP1 gene.

anti-VAMP1 (5F3)

LF-MA10378 100 ug
EUR 363
Description: Mouse monoclonal to VAMP1

Anti-VAMP1 (5A4)

YF-MA10897 100 ug
EUR 363
Description: Mouse monoclonal to VAMP1

Human VAMP1 Antibody (Biotin Conjugate)

32869-05121 150 ug
EUR 369

Anti-VAMP1/2 Monoclonal Antibody

M05982 100ug
EUR 397
Description: Mouse Monoclonal VAMP1/2 Antibody. Validated in ELISA, IHC, WB and tested in Human, Rat.

Monoclonal antibody for VAMP1/2

SMC-179C 0.025mg
EUR 170
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is not conjugated.

Monoclonal antibody for VAMP1/2

SMC-179D 0.1mg
EUR 302
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is not conjugated.

Monoclonal antibody for VAMP1/2

SMC-179D-A390 0.1mg
EUR 349
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 390.

Monoclonal antibody for VAMP1/2

SMC-179D-A488 0.1mg
EUR 348
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 488.

Monoclonal antibody for VAMP1/2

SMC-179D-A565 0.1mg
EUR 348
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 565.

Monoclonal antibody for VAMP1/2

SMC-179D-A594 0.1mg
EUR 348
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 594.

Monoclonal antibody for VAMP1/2

SMC-179D-A633 0.1mg
EUR 348
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 633.

Monoclonal antibody for VAMP1/2

SMC-179D-A655 0.1mg
EUR 348
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 655.

Monoclonal antibody for VAMP1/2

SMC-179D-A680 0.1mg
EUR 348
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 680.

Monoclonal antibody for VAMP1/2

SMC-179D-A700 0.1mg
EUR 348
  • VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
  • Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 700.

VAMP1 Rabbit Polyclonal Antibody