REEP1 Rabbit Polyclonal Antibody

REEP1 Rabbit Polyclonal Antibody

To Order Now:

REEP1 Polyclonal Antibody

ABP60123-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
  • Applications tips:
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110

REEP1 Polyclonal Antibody

ABP60123-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
  • Applications tips:
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110

REEP1 Polyclonal Antibody

ABP60123-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
  • Applications tips:
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110

REEP1 Polyclonal Antibody

ES11440-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against REEP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

REEP1 Polyclonal Antibody

ES11440-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against REEP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

REEP1 Rabbit pAb

A7832-100ul 100 ul
EUR 308

REEP1 Rabbit pAb

A7832-200ul 200 ul
EUR 459

REEP1 Rabbit pAb

A7832-20ul 20 ul
EUR 183

REEP1 Rabbit pAb

A7832-50ul 50 ul
EUR 223

REEP1 Polyclonal Conjugated Antibody

C31353 100ul
EUR 397

REEP1 antibody

70R-19848 50 ul
EUR 435
Description: Rabbit polyclonal REEP1 antibody

REEP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

REEP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

REEP1 Antibody

DF12719 200ul
EUR 304
Description: REEP1 Antibody detects endogenous levels of REEP1.

REEP1 antibody

70R-7241 50 ug
EUR 467
Description: Rabbit polyclonal REEP1 antibody raised against the middle region of REEP1

REEP1 antibody

70R-7467 50 ug
EUR 467
Description: Rabbit polyclonal REEP1 antibody raised against the C terminal of REEP1

REEP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- REEP1 antibody

FNab07229 100µg
EUR 548.75
  • Immunogen: receptor accessory protein 1
  • Uniprot ID: Q9H902
  • Gene ID: 65055
  • Research Area: Metabolism
Description: Antibody raised against REEP1

Anti-REEP1 antibody

PAab07229 100 ug
EUR 386

Anti-REEP1 antibody

STJ110142 100 µl
EUR 277
Description: This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants.

Anti-REEP1 antibody

STJ192598 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to REEP1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Monoclonal antibody for REEP1

SMC-480D 0.1mg
EUR 353
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated.

Monoclonal antibody for REEP1

SMC-480D-A390 0.1mg
EUR 400
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 390.

Monoclonal antibody for REEP1

SMC-480D-A488 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 488.

Monoclonal antibody for REEP1

SMC-480D-A565 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 565.

Monoclonal antibody for REEP1

SMC-480D-A594 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 594.

Monoclonal antibody for REEP1

SMC-480D-A633 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 633.

Monoclonal antibody for REEP1

SMC-480D-A655 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 655.

Monoclonal antibody for REEP1

SMC-480D-A680 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 680.

Monoclonal antibody for REEP1

SMC-480D-A700 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 700.

Monoclonal antibody for REEP1

SMC-480D-ALP 0.1mg
EUR 393
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for REEP1

SMC-480D-APC 0.1mg
EUR 398
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC.

Monoclonal antibody for REEP1

SMC-480D-APCCY7 0.1mg
EUR 470
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC/Cy7.

Monoclonal antibody for REEP1

SMC-480D-BI 0.1mg
EUR 395
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Biotin.

Monoclonal antibody for REEP1

SMC-480D-DY350 0.1mg
EUR 413
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 350.

Monoclonal antibody for REEP1

SMC-480D-DY405 0.1mg
EUR 402
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 405.

Monoclonal antibody for REEP1

SMC-480D-DY488 0.1mg
EUR 392
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 488.

Monoclonal antibody for REEP1

SMC-480D-DY594 0.1mg
EUR 394
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 594.

Monoclonal antibody for REEP1

SMC-480D-DY633 0.1mg
EUR 389
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 633.

Monoclonal antibody for REEP1

SMC-480D-FITC 0.1mg
EUR 391
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with FITC.

Monoclonal antibody for REEP1

SMC-480D-HRP 0.1mg
EUR 387
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with HRP.

Monoclonal antibody for REEP1

SMC-480D-P594 0.1mg
EUR 406
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PE/ATTO 594.

Monoclonal antibody for REEP1

SMC-480D-PCP 0.1mg
EUR 398
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PerCP.

Monoclonal antibody for REEP1

SMC-480D-RPE 0.1mg
EUR 396
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with RPE.

Monoclonal antibody for REEP1

SMC-480D-STR 0.1mg
EUR 397
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Streptavidin.

Monoclonal antibody for REEP1

SMC-480S 0.012mg
EUR 65
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated.

REEP1 Blocking Peptide

33R-2704 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REEP1 antibody, catalog no. 70R-7467

REEP1 Blocking Peptide

33R-1288 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADCYAP1R1 antibody, catalog no. 70R-9939

REEP1 Blocking Peptide

DF12719-BP 1mg
EUR 195

REEP1 cloning plasmid

CSB-CL862045HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atggtgtcatggatcatctccaggctggtggtgcttatatttggcaccctttaccctgcgtattattcctacaaggctgtgaaatcaaaggacattaaggaatatgtcaaatggatgatgtactggattatatttgcacttttcaccacagcagagacattcacagacatcttcct
  • Show more
Description: A cloning plasmid for the REEP1 gene.

Monoclonal antibody for REEP1/2

SMC-482D 0.1mg
EUR 353
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated.

Monoclonal antibody for REEP1/2

SMC-482D-A390 0.1mg
EUR 400
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 390.

Monoclonal antibody for REEP1/2

SMC-482D-A488 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 488.

REEP1 Rabbit Polyclonal Antibody