LITAF Rabbit Polyclonal Antibody

LITAF Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

LITAF Polyclonal Antibody
ES11138-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LITAF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LITAF Polyclonal Antibody
ABP59126-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LITAF protein
  • Applications tips:
Description: A polyclonal antibody for detection of LITAF from Human, Mouse, Rat. This LITAF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LITAF protein

LITAF Polyclonal Antibody
ABP59126-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LITAF protein
  • Applications tips:
Description: A polyclonal antibody for detection of LITAF from Human, Mouse, Rat. This LITAF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LITAF protein

LITAF Polyclonal Antibody
ABP59126-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LITAF protein
  • Applications tips:
Description: A polyclonal antibody for detection of LITAF from Human, Mouse, Rat. This LITAF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LITAF protein

LITAF Antibody
ABD7357 100 ug
EUR 438

LITAF antibody
10R-1149 100 ul
EUR 316
Description: Mouse monoclonal LITAF antibody

LITAF Antibody
32869-100ul 100ul
EUR 252

LITAF antibody
22499-100ul 100ul
EUR 390

LITAF antibody
70R-18285 50 ul
EUR 435
Description: Rabbit polyclonal LITAF antibody

LITAF antibody
70R-13256 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal LITAF antibody

LITAF Antibody
DF7357 200ul
EUR 304
Description: LITAF Antibody detects endogenous levels of total LITAF.

LITAF Antibody
1-CSB-PA012985ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LITAF. Recognizes LITAF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

LITAF Antibody
1-CSB-PA012985GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LITAF. Recognizes LITAF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal LITAF Antibody (internal region)
APR17202G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LITAF (internal region). This antibody is tested and proven to work in the following applications:

[KO Validated] LITAF Rabbit pAb
A5469-100ul 100 ul
EUR 308

[KO Validated] LITAF Rabbit pAb
A5469-200ul 200 ul
EUR 459

[KO Validated] LITAF Rabbit pAb
A5469-20ul 20 ul
EUR 183

[KO Validated] LITAF Rabbit pAb
A5469-50ul 50 ul
EUR 223

LITAF Conjugated Antibody
C32869 100ul
EUR 397

anti- LITAF antibody
FNab04798 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: lipopolysaccharide-induced TNF factor
  • Uniprot ID: Q99732
  • Gene ID: 9516
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against LITAF

Anti-LITAF antibody
PAab04798 100 ug
EUR 355

Anti-LITAF antibody
STJ71339 100 µg
EUR 359

Anti-LITAF antibody
STJ27422 100 µl
EUR 277
Description: Lipopolysaccharide is a potent stimulator of monocytes and macrophages, causing secretion of tumor necrosis factor-alpha (TNF-alpha) and other inflammatory mediators. This gene encodes lipopolysaccharide-induced TNF-alpha factor, which is a DNA-binding protein and can mediate the TNF-alpha expression by direct binding to the promoter region of the TNF-alpha gene. The transcription of this gene is induced by tumor suppressor p53 and has been implicated in the p53-induced apoptotic pathway. Mutations in this gene cause Charcot-Marie-Tooth disease type 1C (CMT1C) and may be involved in the carcinogenesis of extramammary Paget's disease (EMPD). Multiple alternatively spliced transcript variants have been found for this gene.

Anti-LITAF antibody
STJ192296 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LITAF

Litaf/ Rat Litaf ELISA Kit
ELI-16235r 96 Tests
EUR 886

LITAF siRNA
20-abx902997
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LITAF siRNA
20-abx922642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LITAF siRNA
20-abx922643
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-LITAF
YF-PA16360 50 ug
EUR 363
Description: Mouse polyclonal to LITAF

anti-LITAF
YF-PA16361 100 ul
EUR 403
Description: Rabbit polyclonal to LITAF

anti-LITAF
YF-PA16362 100 ug
EUR 403
Description: Rabbit polyclonal to LITAF

LITAF cloning plasmid
CSB-CL859109HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 486
  • Sequence: ATGTCGGTTCCAGGACCTTACCAGGCGGCCACTGGGCCTTCCTCAGCACCATCCGCACCTCCATCCTATGAAGAGACAGTGGCTGTTAACAGTTATTACCCCACACCTCCAGCTCCCATGCCTGGGCCAACTACGGGGCTTGTGACGGGGCCTGATGGGAAGGGCATGAATCCTCC
  • Show more
Description: A cloning plasmid for the LITAF gene.

LITAF Blocking Peptide
DF7357-BP 1mg
EUR 195

Anti-LITAF (2E12)
YF-MA16893 100 ug
EUR 363
Description: Mouse monoclonal to LITAF

Anti-LITAF (KO validated) Antibody
A2075-100 100 µl
EUR 399

Mouse LITAF shRNA Plasmid
20-abx974878
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat LITAF shRNA Plasmid
20-abx986408
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LITAF ELISA KIT
ELI-12371h 96 Tests
EUR 824

Mouse Litaf ELISA KIT
ELI-12372m 96 Tests
EUR 865

LITAF ELISA KIT|Human
EF010691 96 Tests
EUR 689

Chicken LITAF ELISA KIT
ELI-43561c 96 Tests
EUR 928

Human LITAF shRNA Plasmid
20-abx956322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LITAF protein (His tag)
80R-2650 100 ug
EUR 322
Description: Purified recombinant Human LITAF protein (His tag)

LITAF Recombinant Protein (Human)
RP040795 100 ug Ask for price

LITAF Recombinant Protein (Rat)
RP208280 100 ug Ask for price

LITAF Recombinant Protein (Mouse)
RP147635 100 ug Ask for price

Litaf ORF Vector (Rat) (pORF)
ORF069428 1.0 ug DNA
EUR 506

Litaf ORF Vector (Mouse) (pORF)
ORF049213 1.0 ug DNA
EUR 506

LITAF ORF Vector (Human) (pORF)
ORF013599 1.0 ug DNA
EUR 354

LITAF ELISA Kit (Chicken) (OKEH04620)
OKEH04620 96 Wells
EUR 844
Description: Description of target: Probable role in regulating transcription of specific genes.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

LITAF ELISA Kit (Mouse) (OKEH05545)
OKEH05545 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.88 pg/mL

LITAF ELISA Kit (Human) (OKEH05546)
OKEH05546 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.4 pg/mL

LITAF ELISA Kit (Rat) (OKEH06185)
OKEH06185 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

LITAF ELISA Kit (Mouse) (OKEH06713)
OKEH06713 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

LITAF ELISA Kit (Rat) (OKEH06714)
OKEH06714 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Human LPS-induced TNF-alpha Factor (LITAF) Antibody
31398-05111 150 ug
EUR 261

LITAF sgRNA CRISPR Lentivector set (Human)
K1219701 3 x 1.0 ug
EUR 339

Litaf sgRNA CRISPR Lentivector set (Mouse)
K4918501 3 x 1.0 ug
EUR 339

Litaf sgRNA CRISPR Lentivector set (Rat)
K6979201 3 x 1.0 ug
EUR 339

Lipopolysaccharide-Induced Tumor Necrosis Factor-Alpha Factor (LITAF) Antibody
20-abx113527
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lipopolysaccharide-Induced Tumor Necrosis Factor-Alpha Factor (LITAF) Antibody
20-abx004189
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lipopolysaccharide-Induced Tumor Necrosis Factor-Alpha Factor (LITAF) Antibody
20-abx321757
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lipopolysaccharide-Induced Tumor Necrosis Factor-Alpha Factor (LITAF) Antibody
abx432017-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Lipopolysaccharide-Induced Tumor Necrosis Factor-Alpha Factor (LITAF) Antibody
abx234798-100ug 100 ug