RAP1A Rabbit Polyclonal Antibody
RAP1A Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
RAP1A Polyclonal Antibody |
ABP60089-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RAP1A protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RAP1A from Human, Mouse, Rat. This RAP1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAP1A protein |
RAP1A Polyclonal Antibody |
ES11127-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RAP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RAP1A Polyclonal Antibody |
ES11127-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RAP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RAP1A Rabbit pAb |
A0975-100ul |
Abclonal |
100 ul |
EUR 308 |
RAP1A Rabbit pAb |
A0975-200ul |
Abclonal |
200 ul |
EUR 459 |
RAP1A Rabbit pAb |
A0975-20ul |
Abclonal |
20 ul |
EUR 183 |
RAP1A Rabbit pAb |
A0975-50ul |
Abclonal |
50 ul |
EUR 223 |
RAP1A antibody |
22245-100ul |
SAB |
100ul |
EUR 390 |
RAP1A antibody |
70R-19768 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RAP1A antibody |
RAP1A Antibody |
35640-100ul |
SAB |
100ul |
EUR 252 |
RAP1A antibody |
38156-100ul |
SAB |
100ul |
EUR 252 |
RAP1A Antibody |
1-CSB-PA827156 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
RAP1A Antibody |
1-CSB-PA968243 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
RAP1A Antibody |
DF6157 |
Affbiotech |
200ul |
EUR 304 |
Description: RAP1A Antibody detects endogenous levels of total RAP1A. |
RAP1A antibody |
70R-51010 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RAP1A antibody |
RAP1A Antibody |
BF0304 |
Affbiotech |
200ul |
EUR 376 |
Description: RAP1A antibody detects endogenous levels of total RAP1A. |
RAP1A Antibody |
1-CSB-PA019321GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
RAP1A Antibody |
1-CSB-PA019321LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal Rap1a Antibody - middle region |
AMM07522G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rap1a - middle region. This antibody is tested and proven to work in the following applications: |
RAP1A Polyclonal Antibody, Biotin Conjugated |
A60519 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
RAP1A Polyclonal Antibody, FITC Conjugated |
A60520 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
RAP1A Polyclonal Antibody, HRP Conjugated |
A60521 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Polyclonal Rap1a Antibody - C-terminal region |
AMM07521G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rap1a - C-terminal region. This antibody is tested and proven to work in the following applications: |
RAP1A Conjugated Antibody |
C35640 |
SAB |
100ul |
EUR 397 |
Anti-RAP1A Antibody |
PB9816 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-RAP1A antibody |
STJ25296 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. |
Anti-RAP1A antibody |
STJ192285 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RAP1A |
RAP1A siRNA |
20-abx904462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAP1A siRNA |
20-abx930868 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAP1A siRNA |
20-abx930869 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RAP1A |
YF-PA24544 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to RAP1A |
RAP1A Antibody, HRP conjugated |
1-CSB-PA019321LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RAP1A Antibody, FITC conjugated |
1-CSB-PA019321LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RAP1A Antibody, Biotin conjugated |
1-CSB-PA019321LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human Ras-related protein Rap1A (RAP1A) ELISA Kit |
abx251608-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
RAP1A Blocking Peptide |
DF6157-BP |
Affbiotech |
1mg |
EUR 195 |
RAP1A Blocking Peptide |
20-abx063885 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAP1A Blocking Peptide |
BF0304-BP |
Affbiotech |
1mg |
EUR 195 |
RAP1A cloning plasmid |
CSB-CL019321HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 555
- Sequence: atgcgtgagtacaagctagtggtccttggttcaggaggcgttgggaagtctgctctgacagttcagtttgttcagggaatttttgttgaaaaatatgacccaacgatagaagattcctacagaaagcaagttgaagtcgattgccaacagtgtatgctcgaaatcctggatactgc
- Show more
|
Description: A cloning plasmid for the RAP1A gene. |
anti-RAP1A (5F8) |
LF-MA30709 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to RAP1A |
anti-RAP1A (5F8G2) |
LF-MA30710 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to RAP1A |
Recombinant Human Rap1a |
STA-735 |
Cell Biolabs |
10 µg |
EUR 276 |
Description: - Recombinant Human Rap1a is expressed in E. coli and contains a His tag at the N-terminus. 10 µg/vial.
- Recombinant protein is raised in E. coli
- Protein includes a tag
- Recombinant Protein purified from E. coli
|
Anti-RAP1A (3E1) |
YF-MA15102 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RAP1A |
Monoclonal RAP1A Antibody, Clone: 5F8 |
AMM02891G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human RAP1A. The antibodies are raised in Mouse and are from clone 5F8. This antibody is applicable in WB, FC, E |
RAP1A protein (His tag) |
80R-1361 |
Fitzgerald |
50 ug |
EUR 397 |
Description: Purified recombinant Human RAP1A protein |
Rat RAP1A shRNA Plasmid |
20-abx988754 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RAP1A shRNA Plasmid |
20-abx953993 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RAP1A shRNA Plasmid |
20-abx980033 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RAP1A Recombinant Protein (Human) |
RP025744 |
ABM |
100 ug |
Ask for price |
RAP1A Recombinant Protein (Mouse) |
RP166739 |
ABM |
100 ug |
Ask for price |
RAP1A Recombinant Protein (Rat) |
RP223586 |
ABM |
100 ug |
Ask for price |
Ras-Related Protein Rap-1A (RAP1A) Antibody |
20-abx008128 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Ras-Related Protein Rap-1A (RAP1A) Antibody |
abx015976-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Ras-related protein Rap-1A (RAP1A) Antibody |
20-abx213991 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rap1A, Member Of Ras Oncogene Family Antibody |
20-abx115041 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ras-Related Protein Rap-1A (RAP1A) Antibody |
abx011676-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Ras-related protein Rap-1A (RAP1A) Antibody |
20-abx242043 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal RAP1A Antibody (monoclonal) (M01), Clone: 30 |
AMM07520G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human RAP1A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 30. This antibody is applicable in WB, E |
Ras-Related Protein Rap-1A (RAP1A) Antibody |
20-abx301260 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ras-Related Protein Rap-1A (RAP1A) Antibody |
20-abx000928 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rap1a ORF Vector (Rat) (pORF) |
ORF074530 |
ABM |
1.0 ug DNA |
EUR 506 |
RAP1A ORF Vector (Human) (pORF) |
ORF008582 |
ABM |
1.0 ug DNA |
EUR 95 |
Rap1a ORF Vector (Mouse) (pORF) |
ORF055581 |
ABM |
1.0 ug DNA |
EUR 506 |
RAP1A ELISA Kit (Rat) (OKEH03532) |
OKEH03532 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Induces morphological reversion of a cell line transformed by a Ras oncogene. Counteracts the mitogenic function of Ras, at least partly because it can interact with Ras GAPs and RAF in a competitive manner. Together with ITGB1BP1, regulates KRIT1 localization to microtubules and membranes. Plays a role in nerve growth factor (NGF)-induced neurite outgrowth. Plays a role in the regulation of embryonic blood vessel formation. Involved in the establishment of basal endothelial barrier function. May be involved in the regulation of the vascular endothelial growth factor receptor KDR expression at endothelial cell-cell junctions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
RAP1A ELISA Kit (Mouse) (OKEH05134) |
OKEH05134 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Induces morphological reversion of a cell line transformed by a Ras oncogene. Counteracts the mitogenic function of Ras, at least partly because it can interact with Ras GAPs and RAF in a competitive manner. Together with ITGB1BP1, regulates KRIT1 localization to microtubules and membranes. Plays a role in nerve growth factor (NGF)-induced neurite outgrowth. Plays a role in the regulation of embryonic blood vessel formation. Involved in the establishment of basal endothelial barrier function. May be involved in the regulation of the vascular endothelial growth factor receptor KDR expression at endothelial cell-cell junctions.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
Ras-Related Protein Rap-1A (RAP1A) Antibody (HRP) |
20-abx305049 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ras-Related Protein Rap-1A (RAP1A) Antibody (FITC) |
20-abx305050 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ras-Related Protein Rap-1A (RAP1A) Antibody (Biotin) |
20-abx305051 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RAP1A, Member RAS Oncogene Family Protein |
20-abx262895 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Rap1a sgRNA CRISPR Lentivector set (Rat) |
K7257001 |
ABM |
3 x 1.0 ug |
EUR 339 |
RAP1A sgRNA CRISPR Lentivector set (Human) |
K1784701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rap1a sgRNA CRISPR Lentivector set (Mouse) |
K4457901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Human RAP1A, Member RAS Oncogene Family |
7-06058 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human RAP1A, Member RAS Oncogene Family |
7-06059 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human RAP1A, Member RAS Oncogene Family |
7-06060 |
CHI Scientific |
1mg |
Ask for price |
Rap1a sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7257002 |
ABM |
1.0 ug DNA |
EUR 154 |
Rap1a sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7257003 |
ABM |
1.0 ug DNA |
EUR 154 |
Rap1a sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7257004 |
ABM |
1.0 ug DNA |
EUR 154 |
RAP1A sgRNA CRISPR Lentivector (Human) (Target 1) |
K1784702 |
ABM |
1.0 ug DNA |
EUR 154 |
RAP1A sgRNA CRISPR Lentivector (Human) (Target 2) |
K1784703 |
ABM |
1.0 ug DNA |
EUR 154 |
RAP1A sgRNA CRISPR Lentivector (Human) (Target 3) |
K1784704 |
ABM |
1.0 ug DNA |
EUR 154 |
Rap1a sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4457902 |
ABM |
1.0 ug DNA |
EUR 154 |
Rap1a sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4457903 |
ABM |
1.0 ug DNA |
EUR 154 |
Rap1a sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4457904 |
ABM |
1.0 ug DNA |
EUR 154 |
RAP1A Protein Vector (Rat) (pPB-C-His) |
PV298118 |
ABM |
500 ng |
EUR 603 |
RAP1A Protein Vector (Rat) (pPB-N-His) |
PV298119 |
ABM |
500 ng |
EUR 603 |
RAP1A Protein Vector (Rat) (pPM-C-HA) |
PV298120 |
ABM |
500 ng |
EUR 603 |
RAP1A Protein Vector (Rat) (pPM-C-His) |
PV298121 |
ABM |
500 ng |
EUR 603 |
RAP1A Protein Vector (Human) (pPB-C-His) |
PV034325 |
ABM |
500 ng |
EUR 329 |
RAP1A Protein Vector (Human) (pPB-N-His) |
PV034326 |
ABM |
500 ng |
EUR 329 |
RAP1A Protein Vector (Human) (pPM-C-HA) |
PV034327 |
ABM |
500 ng |
EUR 329 |
RAP1A Protein Vector (Human) (pPM-C-His) |
PV034328 |
ABM |
500 ng |
EUR 329 |
RAP1A Protein Vector (Mouse) (pPB-C-His) |
PV222322 |
ABM |
500 ng |
EUR 603 |
RAP1A Protein Vector (Mouse) (pPB-N-His) |
PV222323 |
ABM |
500 ng |
EUR 603 |
RAP1A Protein Vector (Mouse) (pPM-C-HA) |
PV222324 |
ABM |
500 ng |
EUR 603 |
RAP1A Protein Vector (Mouse) (pPM-C-His) |
PV222325 |
ABM |
500 ng |
EUR 603 |
Recombinant Human RAP1A Protein, His, E.coli-10ug |
QP13265-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human RAP1A Protein, His, E.coli-1mg |
QP13265-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human RAP1A Protein, His, E.coli-2ug |
QP13265-2ug |
EnQuireBio |
2ug |
EUR 155 |
Rap1a 3'UTR Luciferase Stable Cell Line |
TU117523 |
ABM |
1.0 ml |
Ask for price |
Rap1a 3'UTR GFP Stable Cell Line |
TU167523 |
ABM |
1.0 ml |
Ask for price |
Rap1a 3'UTR Luciferase Stable Cell Line |
TU217295 |
ABM |
1.0 ml |
Ask for price |
Rap1a 3'UTR GFP Stable Cell Line |
TU267295 |
ABM |
1.0 ml |
Ask for price |
RAP1A 3'UTR GFP Stable Cell Line |
TU069500 |
ABM |
1.0 ml |
EUR 2333 |
RAP1A 3'UTR Luciferase Stable Cell Line |
TU019500 |
ABM |
1.0 ml |
EUR 2333 |
RAP1A ELISA Kit (Human) : 96 Wells (OKEH01696) |
OKEH01696 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG14L Rabbit Polyclonal Antibody |
ABP57583-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG14L
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L |
ATG14L Rabbit Polyclonal Antibody |
ABP57583-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG14L
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L |
ATG14L Rabbit Polyclonal Antibody |
ABP57583-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG14L
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L |
NBR1 Rabbit Polyclonal Antibody |
ABP57585-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NBR1
- Applications tips:
|
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1 |
NBR1 Rabbit Polyclonal Antibody |
ABP57585-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NBR1
- Applications tips:
|
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1 |
NBR1 Rabbit Polyclonal Antibody |
ABP57585-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NBR1
- Applications tips:
|
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1 |
RAP1A Rabbit Polyclonal Antibody