ZBP1 Rabbit Polyclonal Antibody
ZBP1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
ZBP1 Polyclonal Antibody |
ES11422-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ZBP1 Polyclonal Antibody |
ABP60951-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70 |
ZBP1 Polyclonal Antibody |
ABP60951-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70 |
ZBP1 Polyclonal Antibody |
ABP60951-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70 |
ZBP1 Polyclonal Antibody |
28403-100ul |
SAB |
100ul |
EUR 252 |
ZBP1 Polyclonal Antibody |
28403-50ul |
SAB |
50ul |
EUR 187 |
ZBP1 Rabbit pAb |
A13899-100ul |
Abclonal |
100 ul |
EUR 308 |
ZBP1 Rabbit pAb |
A13899-200ul |
Abclonal |
200 ul |
EUR 459 |
ZBP1 Rabbit pAb |
A13899-20ul |
Abclonal |
20 ul |
EUR 183 |
ZBP1 Rabbit pAb |
A13899-50ul |
Abclonal |
50 ul |
EUR 223 |
ZBP1 Polyclonal Conjugated Antibody |
C28403 |
SAB |
100ul |
EUR 397 |
ZBP1 antibody |
70R-21368 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ZBP1 antibody |
ZBP1 Antibody |
24608-100ul |
SAB |
100ul |
EUR 390 |
ZBP1 antibody |
70R-1257 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal ZBP1 antibody raised against the middle region of ZBP1 |
ZBP1 Antibody |
1-CSB-PA026311GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against ZBP1. Recognizes ZBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Rabbit ZBP1 ELISA Kit |
ERTZ0008 |
Abclonal |
96Tests |
EUR 521 |
anti- ZBP1 antibody |
FNab09586 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200
- Immunogen: Z-DNA binding protein 1
- Uniprot ID: Q9H171
- Gene ID: 81030
|
Description: Antibody raised against ZBP1 |
Anti-ZBP1 antibody |
STJ192580 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ZBP1 |
Anti-ZBP1 antibody |
STJ115838 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
ZBP1 siRNA |
20-abx940166 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZBP1 siRNA |
20-abx940167 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZBP1 cloning plasmid |
CSB-CL861990HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 450
- Sequence: atggcccaggctcctgctgacccgggcagagaaggccaccttgaacaaagaatcctgcaggtgctgacagaggctggctccccggtgaaacttgcccagctggtgaaggaatgccaagcacccaagagggagctcaaccaagtcctctaccgaatgaaaaaggagttgaaagtctc
- Show more
|
Description: A cloning plasmid for the ZBP1 gene. |
ZBP1 cloning plasmid |
CSB-CL861990HU2-10ug |
Cusabio |
10ug |
EUR 471 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1290
- Sequence: ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAGGTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCACCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCT
- Show more
|
Description: A cloning plasmid for the ZBP1 gene. |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human) |
4-PAB552Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1) |
Mouse ZBP1 shRNA Plasmid |
20-abx975072 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ZBP1 shRNA Plasmid |
20-abx962944 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ZBP1 ELISA Kit |
EHZ0008 |
Abclonal |
96Tests |
EUR 521 |
Goat ZBP1 ELISA Kit |
EGTZ0008 |
Abclonal |
96Tests |
EUR 521 |
Bovine ZBP1 ELISA Kit |
EBZ0008 |
Abclonal |
96Tests |
EUR 521 |
Chicken ZBP1 ELISA Kit |
ECKZ0008 |
Abclonal |
96Tests |
EUR 521 |
Anserini ZBP1 ELISA Kit |
EAZ0008 |
Abclonal |
96Tests |
EUR 521 |
Canine ZBP1 ELISA Kit |
ECZ0008 |
Abclonal |
96Tests |
EUR 521 |
Porcine ZBP1 ELISA Kit |
EPZ0008 |
Abclonal |
96Tests |
EUR 521 |
ZBP1 Rabbit Polyclonal Antibody