EPYC Rabbit Polyclonal Antibody
EPYC Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
Human Epiphycan (EPYC) ELISA Kit |
RD-EPYC-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Epiphycan (EPYC) ELISA Kit |
RD-EPYC-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
EPYC Polyclonal Antibody |
ABP58493-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
- Applications tips:
|
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220 |
EPYC Polyclonal Antibody |
ABP58493-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
- Applications tips:
|
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220 |
EPYC Polyclonal Antibody |
ABP58493-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
- Applications tips:
|
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220 |
EPYC Polyclonal Antibody |
ES11217-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EPYC Polyclonal Antibody |
ES11217-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Polyclonal EPYC Antibody - middle region |
APR15856G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EPYC - middle region. This antibody is tested and proven to work in the following applications: |
Epiphycan (EPYC) Polyclonal Antibody (Human) |
4-PAJ227Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (His110~Pro317)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC) |
Rabbit Epiphycan (EPYC) ELISA Kit |
abx355328-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Epiphycan (EPYC) Polyclonal Antibody (Human), APC |
4-PAJ227Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (His110~Pro317)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC. |
Epiphycan (EPYC) Polyclonal Antibody (Human), Biotinylated |
4-PAJ227Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (His110~Pro317)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Biotin. |
Epiphycan (EPYC) Polyclonal Antibody (Human), Cy3 |
4-PAJ227Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (His110~Pro317)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Cy3. |
Epiphycan (EPYC) Polyclonal Antibody (Human), FITC |
4-PAJ227Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (His110~Pro317)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with FITC. |
Epiphycan (EPYC) Polyclonal Antibody (Human), HRP |
4-PAJ227Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (His110~Pro317)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with HRP. |
Epiphycan (EPYC) Polyclonal Antibody (Human), PE |
4-PAJ227Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (His110~Pro317)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with PE. |
Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat) |
4-PAJ227Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (Cys130~Ile322)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC) |
Epiphycan (EPYC) Antibody |
20-abx100319 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Epiphycan (EPYC) Antibody |
20-abx129601 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Epiphycan (EPYC) Antibody |
20-abx172275 |
Abbexa |
|
|
|
Anti-EPYC antibody |
STJ192375 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to EPYC |
EPYC siRNA |
20-abx915572 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EPYC siRNA |
20-abx915573 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Epiphycan (EPYC) Polyclonal Antibody (Human), APC-Cy7 |
4-PAJ227Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (His110~Pro317)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC-Cy7. |
Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC |
4-PAJ227Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (Cys130~Ile322)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC. |
Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAJ227Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (Cys130~Ile322)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Biotin. |
Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAJ227Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (Cys130~Ile322)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Cy3. |
Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAJ227Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (Cys130~Ile322)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with FITC. |
Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAJ227Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (Cys130~Ile322)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with HRP. |
Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), PE |
4-PAJ227Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (Cys130~Ile322)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with PE. |
Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAJ227Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EPYC (Cys130~Ile322)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC-Cy7. |
EPYC cloning plasmid |
CSB-CL007757HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 969
- Sequence: atgaagacattagcaggacttgttctgggacttgtcatctttgatgctgctgtgactgccccaactctagagtccatcaactatgactcagaaacctatgatgccaccttagaagacctggataatttgtacaactatgaaaacatacctgttggtaaagttgagattgaaatagc
- Show more
|
Description: A cloning plasmid for the EPYC gene. |
Recombinant Epiphycan (EPYC) |
4-RPJ227Hu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99645
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Epiphycan expressed in: E.coli |
Recombinant Epiphycan (EPYC) |
4-RPJ227Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P70186
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.3kDa
- Isoelectric Point: 6.9
|
Description: Recombinant Mouse Epiphycan expressed in: E.coli |
Anti-EPYC (2G6) |
YF-MA20319 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to EPYC |
Mouse Epiphycan (EPYC) Protein |
20-abx167271 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Epiphycan (EPYC) Protein |
20-abx066448 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse EPYC shRNA Plasmid |
20-abx970068 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EPYC shRNA Plasmid |
20-abx951282 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EPYC Recombinant Protein (Human) |
RP010831 |
ABM |
100 ug |
Ask for price |
EPYC Recombinant Protein (Rat) |
RP199832 |
ABM |
100 ug |
Ask for price |
EPYC Recombinant Protein (Mouse) |
RP132080 |
ABM |
100 ug |
Ask for price |
Human Epiphycan (EPYC)ELISA Kit |
201-12-2676 |
SunredBio |
96 tests |
EUR 440 |
- This Epiphycan ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Epiphycan (EPYC) CLIA Kit |
abx195548-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Epiphycan (EPYC) ELISA Kit |
20-abx151434 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Epiphycan (EPYC) ELISA Kit |
abx252401-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human EPYC(Epiphycan) ELISA Kit |
EH3009 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q99645
- Alias: EPYC/PG-Lb/SLRR3B/Dermatan sulfate proteoglycan 3dermatan sulphate proteoglycan 3/DSPG3proteoglycan-lb/epiphycan/PGLB/Pg-Lb/PG-Lb/Proteoglycan-Lb/SLRR3Bepiphycan proteoglycan/Small chondroitin
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Chicken Epiphycan (EPYC) ELISA Kit |
abx354637-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Epiphycan (EPYC) ELISA Kit |
abx354912-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Epiphycan (EPYC) ELISA Kit |
abx355061-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Epiphycan (EPYC) CLIA Kit |
20-abx495642 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Epyc ORF Vector (Rat) (pORF) |
ORF066612 |
ABM |
1.0 ug DNA |
EUR 506 |
EPYC ORF Vector (Human) (pORF) |
ORF003611 |
ABM |
1.0 ug DNA |
EUR 95 |
Epyc ORF Vector (Mouse) (pORF) |
ORF044028 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Epiphycan (EPYC) ELISA Kit |
SEJ227Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids. |
Human Epiphycan (EPYC) ELISA Kit |
SEJ227Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids. |
Human Epiphycan (EPYC) ELISA Kit |
SEJ227Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids. |
Human Epiphycan (EPYC) ELISA Kit |
SEJ227Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids. |
Human Epiphycan (EPYC) ELISA Kit |
4-SEJ227Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Epiphycan elisa. Alternative names of the recognized antigen: DSPG3
- Pg-Lb
- SLRR3B
- Dermatan Sulphate Proteoglycan 3
- Dermatan Sulfate Proteoglycan 3
- Proteoglycan-Lb
- Small chondroitin/dermatan sulfate proteoglycan
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Epiphycan (EPYC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
EPYC ELISA Kit (Human) (OKCD09160) |
OKCD09160 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Dermatan sulfate proteoglycan 3 is a member of the small leucine-rich repeat proteoglycan family. This gene is composed of seven exons. It regulates fibrillogenesis by interacting with collagen fibrils and other extracellular matrix proteins.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL |
EPYC Rabbit Polyclonal Antibody