GNLY Rabbit Polyclonal Antibody

GNLY Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

Human Granulysin (GNLY) ELISA Kit
RD-GNLY-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Granulysin (GNLY) ELISA Kit
RD-GNLY-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

GNLY Polyclonal Antibody
ABP58659-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human GNLY protein Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody
ABP58659-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GNLY protein Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody
ABP58659-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GNLY protein Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody
ES11035-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNLY Polyclonal Antibody
ES11035-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNLY Antibody
43674-100ul	SAB	100ul	EUR 252

Rabbit Granulysin (GNLY) ELISA Kit
abx355341-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Granulysin (GNLY) Antibody
abx027191-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Granulysin (GNLY) Antibody
abx027191-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Granulysin (GNLY) Antibody
20-abx176697	Abbexa	EUR 1149.00 EUR 565.00	1 mg 200 ug
Please enquire.

Granulysin (GNLY) Antibody
20-abx172666	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

GNLY Conjugated Antibody
C43674	SAB	100ul	EUR 397

Anti-GNLY antibody
STJ192193	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GNLY

GNLY siRNA
20-abx918218	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GNLY
YF-PA17076	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GNLY

Granulysin (GNLY) Protein
20-abx262124	Abbexa	EUR 328.00 EUR 5089.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

GNLY cloning plasmid
CSB-CL009627HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 438 Sequence: atggctacctgggccctcctgctccttgcagccatgctcctgggcaacccaggtctggtcttctctcgtctgagccctgagtactacgacctggcaagagcccacctgcgtgatgaggagaaatcctgcccgtgcctggcccaggagggcccccagggtgacctgttgaccaaaac Show more
Description: A cloning plasmid for the GNLY gene.

Bovine granulysin,GNLY
QY-E60016	Qayee Biotechnology	96T	EUR 426

Anti-GNLY (2A6)
YF-MA17387	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GNLY

Human GNLY ELISA Kit
ELA-E1517h	Lifescience Market	96 Tests	EUR 824

GNLY ELISA KIT|Human
EF000128	Lifescience Market	96 Tests	EUR 689

Human Granulysin (GNLY) Protein
20-abx653629	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human GNLY shRNA Plasmid
20-abx957198	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNLY Recombinant Protein (Human)
RP013579	ABM	100 ug	Ask for price

Human granulysin,GNLY ELISA Kit
201-12-0355	SunredBio	96 tests	EUR 440
This granulysin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Granulysin (GNLY) CLIA Kit
abx197066-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Granulysin (GNLY) ELISA Kit
20-abx151728	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Granulysin (GNLY) ELISA Kit
abx250848-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human GNLY/ Granulysin ELISA Kit
E1028Hu	Sunlong	1 Kit	EUR 571

Human GNLY(Granulysin) ELISA Kit
EH0156	FN Test	96T	EUR 524.1
Detection range: 0.234-15 ng/ml Uniprot ID: P22749 Alias: GNLY(Granulysin)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.141 ng/ml

Human Granulysin, GNLY ELISA KIT
ELI-05002h	Lifescience Market	96 Tests	EUR 824

Human granulysin, GNLY ELISA Kit
CSB-E09936h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granulysin, GNLY ELISA Kit
1-CSB-E09936h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chicken Granulysin (GNLY) ELISA Kit
abx354664-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Granulysin (GNLY) ELISA Kit
abx354943-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Granulysin (GNLY) ELISA Kit
abx355092-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Granulysin (GNLY) ELISA Kit
abx571955-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Granulysin (GNLY) CLIA Kit
20-abx492830	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human granulysin(GNLY)ELISA Kit
GA-E0371HM-48T	GenAsia Biotech	48T	EUR 289

Human granulysin(GNLY)ELISA Kit
GA-E0371HM-96T	GenAsia Biotech	96T	EUR 466

GNLY ORF Vector (Human) (pORF)
ORF004527	ABM	1.0 ug DNA	EUR 95

GNLY Granulysin Human Recombinant Protein
PROTP22749	BosterBio	Regular: 10ug	EUR 317
Description: GNLY Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 159 amino acids and fused to a double His Tag (N+C terminus) and having a total molecular mass of 18.1 kDa.;The GNLY is purified by proprietary chromatographic techniques.

Human granulysin(GNLY)ELISA Kit
QY-E02489	Qayee Biotechnology	96T	EUR 361

Human Granulysin ELISA Kit (GNLY)
RK01482	Abclonal	96 Tests	EUR 521

Human Granulysin (GNLY) ELISA Kit
SEB517Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit
SEB517Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit
SEB517Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit
SEB517Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit
4-SEB517Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Granulysin elisa. Alternative names of the recognized antigen: NKG5 LAG-2 TLA519 T-Lymphocyte Activation Gene 519
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granulysin (GNLY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Bovine granulysin,GNLY ELISA Kit
QY-E60039	Qayee Biotechnology	96T	EUR 426

GNLY ELISA Kit (Human) (OKAN05019)
OKAN05019	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

GNLY ELISA Kit (Human) (OKBB01536)
OKBB01536	Aviva Systems Biology	96 Wells	EUR 570
Description: Description of target: Granulysin is a substance released by cytotoxic T cells(CD8) when they are attached to infected body cells. The product of this gene is a member of the saposin-like protein(SAPLIP) family. It is mapped to 2p11.2. Granulysin functions to create holes in the target cell membrane and destroy it. It is able to induce apoptosis in target cells and also has antimicrobial action. This gene is expressed in cytolytic granules with perforin, a pore forming protein, and granzymes that are also involved in cytolysis. In addition to it, Granulysin is broadly antimicrobial, killing microbes that cause, for example, tuberculosis and malaria, and can destroy some tumors. A series of peptides generated from the amino acid sequence of Granulysin are potential antibiotics. It has been found that secretory Granulysin is a key molecule responsible for the disseminated keratinocyte death in SJS/TEN.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

GNLY ELISA Kit (Human) (OKCD07459)
OKCD07459	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.08ng/mL

CLIA kit for Human GNLY (Granulysin)
E-CL-H1038	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's GNLY CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GNLY (Granulysin)
E-EL-H1618	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GNLY ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GNLY (Granulysin)
ELK2059	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granulysin (GNLY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granulysin (GNLY Show more
Description: A sandwich ELISA kit for detection of Granulysin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GNLY sgRNA CRISPR Lentivector set (Human)
K0878801	ABM	3 x 1.0 ug	EUR 339

GNLY sgRNA CRISPR Lentivector (Human) (Target 1)
K0878802	ABM	1.0 ug DNA	EUR 154

GNLY sgRNA CRISPR Lentivector (Human) (Target 2)
K0878803	ABM	1.0 ug DNA	EUR 154

GNLY sgRNA CRISPR Lentivector (Human) (Target 3)
K0878804	ABM	1.0 ug DNA	EUR 154

GNLY Protein Vector (Human) (pPB-C-His)
PV018105	ABM	500 ng	EUR 329

GNLY Protein Vector (Human) (pPB-N-His)
PV018106	ABM	500 ng	EUR 329

GNLY Protein Vector (Human) (pPM-C-HA)
PV018107	ABM	500 ng	EUR 329

GNLY Protein Vector (Human) (pPM-C-His)
PV018108	ABM	500 ng	EUR 329

Recombinant Human GNLY Protein, His, E.coli-10ug
QP12021-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human GNLY Protein, His, E.coli-1mg
QP12021-1mg	EnQuireBio	1mg	EUR 4153

Recombinant Human GNLY Protein, His, E.coli-2ug
QP12021-2ug	EnQuireBio	2ug	EUR 155

GNLY 3'UTR GFP Stable Cell Line
TU059013	ABM	1.0 ml	EUR 1394

GNLY 3'UTR Luciferase Stable Cell Line
TU009013	ABM	1.0 ml	EUR 1394

GNLY ELISA Kit (Human) : 96 Wells (OKEH02758)
OKEH02758	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

GNLY Rabbit Polyclonal Antibody