SPAG8 Rabbit Polyclonal Antibody

SPAG8 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

SPAG8 Polyclonal Antibody

ABP60486-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein

SPAG8 Polyclonal Antibody

ABP60486-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein

SPAG8 Polyclonal Antibody

ES11041-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SPAG8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

SPAG8 Polyclonal Antibody

ES11041-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SPAG8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

SPAG8 Rabbit pAb

A8943-100ul 100 ul
EUR 308

SPAG8 Rabbit pAb

A8943-200ul 200 ul
EUR 459

SPAG8 Rabbit pAb

A8943-20ul 20 ul
EUR 183

SPAG8 Rabbit pAb

A8943-50ul 50 ul
EUR 223

SPAG8 antibody

70R-20476 50 ul
EUR 435
Description: Rabbit polyclonal SPAG8 antibody

SPAG8 antibody

70R-2385 50 ug
EUR 467
Description: Rabbit polyclonal SPAG8 antibody raised against the N terminal of SPAG8

SPAG8 antibody

70R-2386 50 ug
EUR 467
Description: Rabbit polyclonal SPAG8 antibody raised against the middle region of SPAG8

SPAG8 Antibody

35927-100ul 100ul
EUR 252

SPAG8 Antibody

1-CSB-PA858730LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

SPAG8 Antibody

1-CSB-PA269500
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

SPAG8 Antibody

1-CSB-PA209919
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

SPAG8 Antibody

1-CSB-PA022469GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SPAG8 Polyclonal Antibody, HRP Conjugated

A69156 100 ?g
EUR 628.55
Description: kits suitable for this type of research

SPAG8 Polyclonal Antibody, FITC Conjugated

A69157 100 ?g
EUR 628.55
Description: fast delivery possible

SPAG8 Polyclonal Antibody, Biotin Conjugated

A69158 100 ?g
EUR 628.55
Description: reagents widely cited

SPAG8 Conjugated Antibody

C35927 100ul
EUR 397

anti- SPAG8 antibody

FNab08146 100µg
EUR 548.75
  • Immunogen: sperm associated antigen 8
  • Uniprot ID: Q99932
  • Gene ID: 26206
  • Research Area: Stem Cells
Description: Antibody raised against SPAG8

Anti-SPAG8 antibody

PAab08146 100 ug
EUR 386

Anti-SPAG8 antibody

STJ113600 100 µl
EUR 277
Description: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined.

Anti-SPAG8 antibody

STJ192199 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPAG8

SPAG8 siRNA

20-abx934799
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pBlueScriptR-SPAG8

PVT17301 2 ug
EUR 231

anti-SPAG8

YF-PA18238 50 ul
EUR 363
Description: Mouse polyclonal to SPAG8

anti-SPAG8

YF-PA18239 50 ug
EUR 363
Description: Mouse polyclonal to SPAG8

SPAG8 Antibody, HRP conjugated

1-CSB-PA858730LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPAG8 Antibody, FITC conjugated

1-CSB-PA858730LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SPAG8 Antibody, Biotin conjugated

1-CSB-PA858730LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SPAG8 Blocking Peptide

33R-8479 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2385

SPAG8 Blocking Peptide

33R-6974 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2386

SPAG8 cloning plasmid

CSB-CL858730HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggagaccaacgggtctacggagggatcgcggtcgcggtcgcgatctttagacatacagcccagctccgaaggactggggcccacttcggaaccgtttccttcttcagatgacagtcccaggtcggccctggcagctgcaaccgcagcagctgcagcggctgcatcagctgctg
  • Show more
Description: A cloning plasmid for the SPAG8 gene.

Anti-SPAG8 (2F12)

YF-MA18062 100 ug
EUR 363
Description: Mouse monoclonal to SPAG8

SPAG8 ELISA KIT|Human

EF003162 96 Tests
EUR 689

Human SPAG8 shRNA Plasmid

20-abx958755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SPAG8 Recombinant Protein (Rat)

RP230627 100 ug Ask for price

SPAG8 Recombinant Protein (Human)

RP029767 100 ug Ask for price

SPAG8 Recombinant Protein (Mouse)

RP174728 100 ug Ask for price

Sperm Associated Antigen 8 (SPAG8) Antibody

20-abx115763
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

abx122908-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

20-abx124599
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

abx238146-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

20-abx339750
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

20-abx339751
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody

20-abx333753
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody (HRP)

20-abx337781
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody (FITC)

20-abx337782
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sperm-Associated Antigen 8 (SPAG8) Antibody (Biotin)

20-abx337783
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Spag8 ORF Vector (Rat) (pORF)

ORF076877 1.0 ug DNA
EUR 506

SPAG8 ORF Vector (Human) (pORF)

ORF009923 1.0 ug DNA
EUR 95

Spag8 ORF Vector (Mouse) (pORF)

ORF058244 1.0 ug DNA
EUR 506

Spag8 sgRNA CRISPR Lentivector set (Rat)

K6142601 3 x 1.0 ug
EUR 339

Spag8 sgRNA CRISPR Lentivector set (Mouse)

K3028801 3 x 1.0 ug
EUR 339

SPAG8 sgRNA CRISPR Lentivector set (Human)

K2264601 3 x 1.0 ug
EUR 339

Spag8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6142602 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6142603 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6142604 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3028802 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3028803 1.0 ug DNA
EUR 154

Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3028804 1.0 ug DNA
EUR 154

SPAG8 sgRNA CRISPR Lentivector (Human) (Target 1)

K2264602 1.0 ug DNA
EUR 154

SPAG8 sgRNA CRISPR Lentivector (Human) (Target 2)

K2264603 1.0 ug DNA
EUR 154

SPAG8 sgRNA CRISPR Lentivector (Human) (Target 3)

K2264604 1.0 ug DNA
EUR 154

SPAG8 Protein Vector (Rat) (pPB-C-His)

PV307506 500 ng
EUR 603

SPAG8 Protein Vector (Rat) (pPB-N-His)

PV307507 500 ng
EUR 603

SPAG8 Protein Vector (Rat) (pPM-C-HA)

PV307508 500 ng
EUR 603

SPAG8 Protein Vector (Rat) (pPM-C-His)

PV307509 500 ng
EUR 603

SPAG8 Protein Vector (Human) (pPB-C-His)

PV039689 500 ng
EUR 329

SPAG8 Protein Vector (Human) (pPB-N-His)

PV039690 500 ng
EUR 329

SPAG8 Protein Vector (Human) (pPM-C-HA)

PV039691 500 ng
EUR 329

SPAG8 Protein Vector (Human) (pPM-C-His)

PV039692 500 ng
EUR 329

SPAG8 Protein Vector (Mouse) (pPB-C-His)

PV232974 500 ng
EUR 603

SPAG8 Protein Vector (Mouse) (pPB-N-His)

PV232975 500 ng
EUR 603

SPAG8 Protein Vector (Mouse) (pPM-C-HA)

PV232976 500 ng
EUR 603

SPAG8 Protein Vector (Mouse) (pPM-C-His)

PV232977 500 ng
EUR 603

Spag8 3'UTR Luciferase Stable Cell Line

TU119522 1.0 ml Ask for price

Spag8 3'UTR GFP Stable Cell Line

TU169522 1.0 ml Ask for price

Spag8 3'UTR Luciferase Stable Cell Line

TU221024 1.0 ml Ask for price

Spag8 3'UTR GFP Stable Cell Line

TU271024 1.0 ml Ask for price

SPAG8 3'UTR GFP Stable Cell Line

TU074378 1.0 ml
EUR 1521

SPAG8 3'UTR Luciferase Stable Cell Line

TU024378 1.0 ml
EUR 1521

Human Sperm- associated antigen 8, SPAG8 ELISA KIT

ELI-29622h 96 Tests
EUR 824

Human Sperm-Associated Antigen 8 (SPAG8) ELISA Kit

abx383397-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

SPAG8 Rabbit Polyclonal Antibody