RSPO2 Rabbit Polyclonal Antibody

RSPO2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

RSPO2 Polyclonal Antibody

ABP60271-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RSPO2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO2 from Human, Mouse. This RSPO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO2 protein

RSPO2 Polyclonal Antibody

ES11063-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RSPO2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RSPO2 Polyclonal Antibody

ES11063-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RSPO2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RSPO2 antibody

70R-20031 50 ul
EUR 435
Description: Rabbit polyclonal RSPO2 antibody

RSPO2 Antibody

1-CSB-PA020551GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RSPO2. Recognizes RSPO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal RSPO2 Antibody (C-term)

APR05604G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO2 (C-term). This antibody is tested and proven to work in the following applications:

anti- RSPO2 antibody

FNab07511 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:1000
  • Immunogen: R-spondin 2 homolog
  • Uniprot ID: Q6UXX9
  • Gene ID: 340419
  • Research Area: Neuroscience, Cardiovascular
Description: Antibody raised against RSPO2

Anti-RSPO2 antibody

PAab07511 100 ug
EUR 386

Anti-RSPO2 antibody

STJ192221 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RSPO2

RSPO2 siRNA

20-abx932213
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RSPO2 siRNA

20-abx932214
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RSPO2 cloning plasmid

CSB-CL751021HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 531
  • Sequence: atgcgccagtatggagagtgcctgcattcctgcccatccgggtactatggacaccgagccccagatatgaacagatgtgcaagatgcagaatagaaaactgtgattcttgctttagcaaagacttttgtaccaagtgcaaagtaggcttttatttgcatagaggccgttgctttga
  • Show more
Description: A cloning plasmid for the RSPO2 gene.

R-Spondin 2 (RSPO2) Antibody

20-abx115343
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

R-Spondin 2 (RSPO2) Antibody

abx032461-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

R-Spondin 2 (RSPO2) Antibody

abx032461-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

R-Spondin 2 (RSPO2) Antibody

abx237511-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RSPO2 ELISA KIT|Human

EF002661 96 Tests
EUR 689

Human RSPO2 shRNA Plasmid

20-abx967344
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RSPO2 shRNA Plasmid

20-abx982386
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-RSPO2 Plasmid

PVT16271 2 ug
EUR 325

RSPO2 Recombinant Protein (Human)

RP027343 100 ug Ask for price

RSPO2 Recombinant Protein (Rat)

RP227027 100 ug Ask for price

RSPO2 Recombinant Protein (Mouse)

RP169487 100 ug Ask for price

Rspo2 ORF Vector (Rat) (pORF)

ORF075677 1.0 ug DNA
EUR 506

RSPO2 ORF Vector (Human) (pORF)

ORF009115 1.0 ug DNA
EUR 95

Rspo2 ORF Vector (Mouse) (pORF)

ORF056497 1.0 ug DNA
EUR 506

RSPO2 ELISA Kit (Human) (OKAN06303)

OKAN06303 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the R-spondin family of proteins. These proteins are secreted ligands of leucine-rich repeat containing G protein-coupled receptors that enhance Wnt signaling through the inhibition of ubiquitin E3 ligases. A chromosomal translocation including this locus that results in the formation of a gene fusion has been identified in multiple human cancers. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

RSPO2 ELISA Kit (Human) (OKCD02064)

OKCD02064 96 Wells
EUR 909
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors. Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Probably also acts as a ligand for frizzled and LRP receptors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.1 pg/mL

Rspo2 ELISA Kit (Mouse) (OKCD02065)

OKCD02065 96 Wells
EUR 936
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors. Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Probably also acts as a ligand for frizzled and LRP receptors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 29 pg/mL

RSPO2 ELISA Kit (Human) (OKCA02143)

OKCA02143 96 Wells
EUR 833
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors. Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Probably also acts as a ligand for frizzled and LRP receptors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.039 ng/mL.

RSPO2 ELISA Kit (Mouse) (OKCA02189)

OKCA02189 96 Wells
EUR 833
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors. Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Probably also acts as a ligand for frizzled and LRP receptors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

Rspo2 sgRNA CRISPR Lentivector set (Rat)

K7583201 3 x 1.0 ug
EUR 339

Rspo2 sgRNA CRISPR Lentivector set (Mouse)

K4852701 3 x 1.0 ug
EUR 339

RSPO2 sgRNA CRISPR Lentivector set (Human)

K2074501 3 x 1.0 ug
EUR 339

Human R-spondin-2(RSPO2) ELISA kit

CSB-EL020551HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human R-spondin-2 (RSPO2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human R-spondin-2(RSPO2) ELISA kit

1-CSB-EL020551HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human R-spondin-2(RSPO2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse R-spondin-2(RSPO2) ELISA kit

CSB-EL020551MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse R-spondin-2 (RSPO2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse R-spondin-2(RSPO2) ELISA kit

1-CSB-EL020551MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse R-spondin-2(RSPO2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human R-Spondin 2 (RSPO2) ELISA Kit

20-abx258155
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse R-Spondin 2 (RSPO2) ELISA Kit

20-abx258663
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human R- spondin- 2, RSPO2 ELISA KIT

ELI-21586h 96 Tests
EUR 824

Human R-Spondin 2 (RSPO2) CLIA Kit

20-abx496029
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse R-Spondin 2 (RSPO2) CLIA Kit

20-abx496030
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse R- spondin- 2, Rspo2 ELISA KIT

ELI-38708m 96 Tests
EUR 865

Rspo2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7583202 1.0 ug DNA
EUR 154

Rspo2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7583203 1.0 ug DNA
EUR 154

Rspo2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7583204 1.0 ug DNA
EUR 154

Rspo2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4852702 1.0 ug DNA
EUR 154

Rspo2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4852703 1.0 ug DNA
EUR 154

Rspo2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4852704 1.0 ug DNA
EUR 154

RSPO2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2074502 1.0 ug DNA
EUR 154

RSPO2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2074503 1.0 ug DNA
EUR 154

RSPO2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2074504 1.0 ug DNA
EUR 154

RSPO2 Protein Vector (Rat) (pPB-C-His)

PV302706 500 ng
EUR 603

RSPO2 Protein Vector (Rat) (pPB-N-His)

PV302707 500 ng
EUR 603

RSPO2 Protein Vector (Rat) (pPM-C-HA)

PV302708 500 ng
EUR 603

RSPO2 Protein Vector (Rat) (pPM-C-His)

PV302709 500 ng
EUR 603

RSPO2 Protein Vector (Mouse) (pPB-C-His)

PV225986 500 ng
EUR 603

RSPO2 Protein Vector (Mouse) (pPB-N-His)

PV225987 500 ng
EUR 603

RSPO2 Protein Vector (Mouse) (pPM-C-HA)

PV225988 500 ng
EUR 603

RSPO2 Protein Vector (Mouse) (pPM-C-His)

PV225989 500 ng
EUR 603

Human R-Spondin 2(RSPO2)ELISA Kit

QY-E04634 96T
EUR 361

Human R-Spondin 2 ELISA Kit (RSPO2)

RK02215 96 Tests
EUR 521

RSPO2 Protein Vector (Human) (pPB-C-His)

PV036457 500 ng
EUR 329

RSPO2 Protein Vector (Human) (pPB-N-His)

PV036458 500 ng
EUR 329

RSPO2 Protein Vector (Human) (pPM-C-HA)

PV036459 500 ng
EUR 329

RSPO2 Protein Vector (Human) (pPM-C-His)

PV036460 500 ng
EUR 329

Rspo2 3'UTR Luciferase Stable Cell Line

TU118225 1.0 ml Ask for price

Human R-Spondin 2 (RSPO2) ELISA Kit

SEM172Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids.

Human R-Spondin 2 (RSPO2) ELISA Kit

SEM172Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids.

Human R-Spondin 2 (RSPO2) ELISA Kit

SEM172Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids.

Human R-Spondin 2 (RSPO2) ELISA Kit

SEM172Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids.

Human R-Spondin 2 (RSPO2) ELISA Kit

4-SEM172Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as R-Spondin 2 elisa. Alternative names of the recognized antigen: Roof plate-specific spondin-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human R-Spondin 2 (RSPO2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse R-Spondin 2 (RSPO2) ELISA Kit

SEM172Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse R-Spondin 2 (RSPO2) ELISA Kit

SEM172Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse R-Spondin 2 (RSPO2) ELISA Kit

SEM172Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse R-Spondin 2 (RSPO2) ELISA Kit

SEM172Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse R-Spondin 2 (RSPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse R-Spondin 2 (RSPO2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse R-Spondin 2 (RSPO2) ELISA Kit

4-SEM172Mu
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as R-Spondin 2 elisa. Alternative names of the recognized antigen: Roof plate-specific spondin-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse R-Spondin 2 (RSPO2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rspo2 3'UTR GFP Stable Cell Line

TU168225 1.0 ml Ask for price

Rspo2 3'UTR Luciferase Stable Cell Line

TU219762 1.0 ml Ask for price

Rspo2 3'UTR GFP Stable Cell Line

TU269762 1.0 ml Ask for price

RSPO2 3'UTR GFP Stable Cell Line

TU072440 1.0 ml
EUR 1521

RSPO2 3'UTR Luciferase Stable Cell Line

TU022440 1.0 ml
EUR 1521

ELISA kit for Human RSPO2 (R-Spondin 2)

ELK7457 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to R-Spondin 2 (RSPO2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R-Spondin 2 (R
  • Show more
Description: A sandwich ELISA kit for detection of R-Spondin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse RSPO2 (R-Spondin 2)

ELK8153 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to R-Spondin 2 (RSPO2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R-Spondin 2 (R
  • Show more
Description: A sandwich ELISA kit for detection of R-Spondin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RSPO2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV649969 1.0 ug DNA
EUR 514

RSPO2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV649973 1.0 ug DNA
EUR 514

RSPO2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV649974 1.0 ug DNA
EUR 514

ELISA kit for Human R-spondin-2 (RSPO2)

KTE60782-48T 48T
EUR 332
  • R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
  • Show more
Description: Quantitative sandwich ELISA for measuring Human R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human R-spondin-2 (RSPO2)

KTE60782-5platesof96wells 5 plates of 96 wells
EUR 2115
  • R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
  • Show more
Description: Quantitative sandwich ELISA for measuring Human R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human R-spondin-2 (RSPO2)

KTE60782-96T 96T
EUR 539
  • R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
  • Show more
Description: Quantitative sandwich ELISA for measuring Human R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse R-spondin-2 (RSPO2)

KTE70495-48T 48T
EUR 332
  • R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse R-spondin-2 (RSPO2)

KTE70495-5platesof96wells 5 plates of 96 wells
EUR 2115
  • R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse R-spondin-2 (RSPO2)

KTE70495-96T 96T
EUR 539
  • R-spondins (RSPOs), such as RSPO2, are secreted proteins that regulate beta-catenin (CTNNB1) signaling. Xenopus and human RSPO2 enhanced mouse Wnt3a signaling in transfected human embryonic kidney cells. C-terminally truncated Xenopus Rspo2, but not
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse R-spondin-2 (RSPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

RSPO2 Rabbit Polyclonal Antibody