MXI1 Rabbit Polyclonal Antibody
MXI1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
MXI1 Polyclonal Antibody |
ES11015-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MXI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MXI1 Rabbit pAb |
A12098-100ul |
Abclonal |
100 ul |
EUR 308 |
MXI1 Rabbit pAb |
A12098-200ul |
Abclonal |
200 ul |
EUR 459 |
MXI1 Rabbit pAb |
A12098-20ul |
Abclonal |
20 ul |
EUR 183 |
MXI1 Rabbit pAb |
A12098-50ul |
Abclonal |
50 ul |
EUR 223 |
MXI1 Rabbit pAb |
A6661-100ul |
Abclonal |
100 ul |
EUR 308 |
MXI1 Rabbit pAb |
A6661-200ul |
Abclonal |
200 ul |
EUR 459 |
MXI1 Rabbit pAb |
A6661-20ul |
Abclonal |
20 ul |
EUR 183 |
MXI1 Rabbit pAb |
A6661-50ul |
Abclonal |
50 ul |
EUR 223 |
MXI1 antibody |
39081-100ul |
SAB |
100ul |
EUR 252 |
MXI1 antibody |
10R-1598 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal MXI1 antibody |
MXI1 Antibody |
1-CSB-PA015254LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
MXI1 Conjugated Antibody |
C39081 |
SAB |
100ul |
EUR 397 |
Anti-MXI1 antibody |
STJ28744 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally. |
Anti-MXI1 antibody |
STJ113993 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally. |
Anti-MXI1 antibody |
STJ192173 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MXI1 |
MXI1 siRNA |
20-abx925077 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MXI1 siRNA |
20-abx925078 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MXI1 |
YF-PA13285 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to MXI1 |
anti-MXI1 |
YF-PA13286 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to MXI1 |
MXI1 Antibody, HRP conjugated |
1-CSB-PA015254LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MXI1 Antibody, FITC conjugated |
1-CSB-PA015254LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MXI1 Antibody, Biotin conjugated |
1-CSB-PA015254LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MXI1 cloning plasmid |
CSB-CL015254HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 549
- Sequence: atgccgagcccccgactgcagcattcaaagcccccacggaggttgagccgggcacagaaacacagcagcgggagcagcaacaccagcactgccaacagacgagctcatctgcgcctttgtttagaacgcttaaaagttctgattccactaggaccagactgcacccggcacacaac
- Show more
|
Description: A cloning plasmid for the MXI1 gene. |
MXI1 cloning plasmid |
CSB-CL015254HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 705
- Sequence: atggagaagcacatcaacacttttctgcagaacgtgcagattctgctcgaggccgccagctacctggagcagatcgagaaagaaaacaaaaagtgtgaacatggctacgcctcttcattcccgtccatgccgagcccccgactgcagcattcaaagcccccacggaggttgagccg
- Show more
|
Description: A cloning plasmid for the MXI1 gene. |
Anti-MXI1 (1F3) |
YF-MA14338 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MXI1 |
Anti-MXI1 (1B10) |
YF-MA14339 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MXI1 |
Mouse MXI1 shRNA Plasmid |
20-abx971633 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MXI1 shRNA Plasmid |
20-abx953032 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MXI1 Recombinant Protein (Human) |
RP020437 |
ABM |
100 ug |
Ask for price |
MXI1 Recombinant Protein (Human) |
RP020440 |
ABM |
100 ug |
Ask for price |
MXI1 Recombinant Protein (Mouse) |
RP152423 |
ABM |
100 ug |
Ask for price |
MXI1 Recombinant Protein (Mouse) |
RP152426 |
ABM |
100 ug |
Ask for price |
MXI1 Recombinant Protein (Mouse) |
RP152429 |
ABM |
100 ug |
Ask for price |
MXI1 Recombinant Protein (Rat) |
RP212846 |
ABM |
100 ug |
Ask for price |
Max-Interacting Protein 1 (MXI1) Antibody |
20-abx005107 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Max-Interacting Protein 1 (MXI1) Antibody |
20-abx126203 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Max-Interacting Protein 1 (MXI1) Antibody |
abx145977-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Max-Interacting Protein 1 (MXI1) Antibody |
abx028460-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Max-Interacting Protein 1 (MXI1) Antibody |
abx028460-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Max-Interacting Protein 1 (MXI1) Antibody |
20-abx301097 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Max-Interacting Protein 1 (MXI1) Antibody (HRP) |
20-abx317030 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Max-Interacting Protein 1 (MXI1) Antibody (FITC) |
20-abx317031 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Max-Interacting Protein 1 (MXI1) Antibody (Biotin) |
20-abx317032 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mxi1 ORF Vector (Rat) (pORF) |
ORF070950 |
ABM |
1.0 ug DNA |
EUR 506 |
MXI1 ORF Vector (Human) (pORF) |
ORF006813 |
ABM |
1.0 ug DNA |
EUR 95 |
MXI1 ORF Vector (Human) (pORF) |
ORF006814 |
ABM |
1.0 ug DNA |
EUR 95 |
Mxi1 ORF Vector (Mouse) (pORF) |
ORF050809 |
ABM |
1.0 ug DNA |
EUR 506 |
Mxi1 ORF Vector (Mouse) (pORF) |
ORF050810 |
ABM |
1.0 ug DNA |
EUR 506 |
Mxi1 ORF Vector (Mouse) (pORF) |
ORF050811 |
ABM |
1.0 ug DNA |
EUR 506 |
Mxi1 sgRNA CRISPR Lentivector set (Mouse) |
K4790001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mxi1 sgRNA CRISPR Lentivector set (Rat) |
K6820501 |
ABM |
3 x 1.0 ug |
EUR 339 |
MXI1 sgRNA CRISPR Lentivector set (Human) |
K1370201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4790002 |
ABM |
1.0 ug DNA |
EUR 154 |
Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4790003 |
ABM |
1.0 ug DNA |
EUR 154 |
Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4790004 |
ABM |
1.0 ug DNA |
EUR 154 |
Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6820502 |
ABM |
1.0 ug DNA |
EUR 154 |
Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6820503 |
ABM |
1.0 ug DNA |
EUR 154 |
Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6820504 |
ABM |
1.0 ug DNA |
EUR 154 |
MXI1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1370202 |
ABM |
1.0 ug DNA |
EUR 154 |
MXI1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1370203 |
ABM |
1.0 ug DNA |
EUR 154 |
MXI1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1370204 |
ABM |
1.0 ug DNA |
EUR 154 |
MXI1 Protein Vector (Mouse) (pPB-C-His) |
PV203234 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPB-N-His) |
PV203235 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPM-C-HA) |
PV203236 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPM-C-His) |
PV203237 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPB-C-His) |
PV203238 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPB-N-His) |
PV203239 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPM-C-HA) |
PV203240 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPM-C-His) |
PV203241 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPB-C-His) |
PV203242 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPB-N-His) |
PV203243 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPM-C-HA) |
PV203244 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Mouse) (pPM-C-His) |
PV203245 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Rat) (pPB-C-His) |
PV283798 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Rat) (pPB-N-His) |
PV283799 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Rat) (pPM-C-HA) |
PV283800 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Rat) (pPM-C-His) |
PV283801 |
ABM |
500 ng |
EUR 603 |
MXI1 Protein Vector (Human) (pPB-C-His) |
PV027249 |
ABM |
500 ng |
EUR 329 |
MXI1 Protein Vector (Human) (pPB-N-His) |
PV027250 |
ABM |
500 ng |
EUR 329 |
MXI1 Protein Vector (Human) (pPM-C-HA) |
PV027251 |
ABM |
500 ng |
EUR 329 |
MXI1 Protein Vector (Human) (pPM-C-His) |
PV027252 |
ABM |
500 ng |
EUR 329 |
MXI1 Protein Vector (Human) (pPB-C-His) |
PV027253 |
ABM |
500 ng |
EUR 329 |
MXI1 Protein Vector (Human) (pPB-N-His) |
PV027254 |
ABM |
500 ng |
EUR 329 |
MXI1 Protein Vector (Human) (pPM-C-HA) |
PV027255 |
ABM |
500 ng |
EUR 329 |
MXI1 Protein Vector (Human) (pPM-C-His) |
PV027256 |
ABM |
500 ng |
EUR 329 |
Mxi1 3'UTR Luciferase Stable Cell Line |
TU113670 |
ABM |
1.0 ml |
Ask for price |
Mxi1 3'UTR GFP Stable Cell Line |
TU163670 |
ABM |
1.0 ml |
Ask for price |
Mxi1 3'UTR Luciferase Stable Cell Line |
TU213592 |
ABM |
1.0 ml |
Ask for price |
Mxi1 3'UTR GFP Stable Cell Line |
TU263592 |
ABM |
1.0 ml |
Ask for price |
MXI1 3'UTR GFP Stable Cell Line |
TU064996 |
ABM |
1.0 ml |
EUR 1521 |
MXI1 3'UTR Luciferase Stable Cell Line |
TU014996 |
ABM |
1.0 ml |
EUR 1521 |
Human Max- interacting protein 1, MXI1 ELISA KIT |
ELI-20014h |
Lifescience Market |
96 Tests |
EUR 824 |
MXI1 Rabbit Polyclonal Antibody