MXI1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

MXI1 Polyclonal Antibody
ES11015-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MXI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MXI1 Rabbit pAb
A12098-100ul	Abclonal	100 ul	EUR 308

MXI1 Rabbit pAb
A12098-200ul	Abclonal	200 ul	EUR 459

MXI1 Rabbit pAb
A12098-20ul	Abclonal	20 ul	EUR 183

MXI1 Rabbit pAb
A12098-50ul	Abclonal	50 ul	EUR 223

MXI1 Rabbit pAb
A6661-100ul	Abclonal	100 ul	EUR 308

MXI1 Rabbit pAb
A6661-200ul	Abclonal	200 ul	EUR 459

MXI1 Rabbit pAb
A6661-20ul	Abclonal	20 ul	EUR 183

MXI1 Rabbit pAb
A6661-50ul	Abclonal	50 ul	EUR 223

MXI1 antibody
39081-100ul	SAB	100ul	EUR 252

MXI1 antibody
10R-1598	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal MXI1 antibody

MXI1 Antibody
1-CSB-PA015254LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MXI1 Conjugated Antibody
C39081	SAB	100ul	EUR 397

Anti-MXI1 antibody
STJ28744	St John's Laboratory	100 µl	EUR 277
Description: Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally.

Anti-MXI1 antibody
STJ113993	St John's Laboratory	100 µl	EUR 277
Description: Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally.

Anti-MXI1 antibody
STJ192173	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MXI1

Mxi1/ Rat Mxi1 ELISA Kit
ELI-39465r	Lifescience Market	96 Tests	EUR 886

MXI1 siRNA
20-abx925077	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MXI1 siRNA
20-abx925078	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-MXI1
YF-PA13285	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to MXI1

anti-MXI1
YF-PA13286	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to MXI1

MXI1 Antibody, HRP conjugated
1-CSB-PA015254LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MXI1 Antibody, FITC conjugated
1-CSB-PA015254LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MXI1 Antibody, Biotin conjugated
1-CSB-PA015254LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MXI1 cloning plasmid
CSB-CL015254HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 549 Sequence: atgccgagcccccgactgcagcattcaaagcccccacggaggttgagccgggcacagaaacacagcagcgggagcagcaacaccagcactgccaacagacgagctcatctgcgcctttgtttagaacgcttaaaagttctgattccactaggaccagactgcacccggcacacaac Show more
Description: A cloning plasmid for the MXI1 gene.

MXI1 cloning plasmid
CSB-CL015254HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 705 Sequence: atggagaagcacatcaacacttttctgcagaacgtgcagattctgctcgaggccgccagctacctggagcagatcgagaaagaaaacaaaaagtgtgaacatggctacgcctcttcattcccgtccatgccgagcccccgactgcagcattcaaagcccccacggaggttgagccg Show more
Description: A cloning plasmid for the MXI1 gene.

pCMV-SPORT6-MXI1
PVT14066	Lifescience Market	2 ug	EUR 391

pCMV-SPORT6-MXI1
PVT14208	Lifescience Market	2 ug	EUR 495

Anti-MXI1 (1F3)
YF-MA14338	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MXI1

Anti-MXI1 (1B10)
YF-MA14339	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MXI1

MXI1 ELISA KIT|Human
EF005248	Lifescience Market	96 Tests	EUR 689

Mouse MXI1 shRNA Plasmid
20-abx971633	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MXI1 shRNA Plasmid
20-abx953032	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MXI1 Recombinant Protein (Human)
RP020437	ABM	100 ug	Ask for price

MXI1 Recombinant Protein (Human)
RP020440	ABM	100 ug	Ask for price

MXI1 Recombinant Protein (Mouse)
RP152423	ABM	100 ug	Ask for price

MXI1 Recombinant Protein (Mouse)
RP152426	ABM	100 ug	Ask for price

MXI1 Recombinant Protein (Mouse)
RP152429	ABM	100 ug	Ask for price

MXI1 Recombinant Protein (Rat)
RP212846	ABM	100 ug	Ask for price

Max-Interacting Protein 1 (MXI1) Antibody
20-abx005107	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody
20-abx126203	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody
abx145977-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody
abx028460-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody
abx028460-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody
20-abx301097	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody (HRP)
20-abx317030	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody (FITC)
20-abx317031	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody (Biotin)
20-abx317032	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mxi1 ORF Vector (Rat) (pORF)
ORF070950	ABM	1.0 ug DNA	EUR 506

MXI1 ORF Vector (Human) (pORF)
ORF006813	ABM	1.0 ug DNA	EUR 95

MXI1 ORF Vector (Human) (pORF)
ORF006814	ABM	1.0 ug DNA	EUR 95

Mxi1 ORF Vector (Mouse) (pORF)
ORF050809	ABM	1.0 ug DNA	EUR 506

Mxi1 ORF Vector (Mouse) (pORF)
ORF050810	ABM	1.0 ug DNA	EUR 506

Mxi1 ORF Vector (Mouse) (pORF)
ORF050811	ABM	1.0 ug DNA	EUR 506

Mxi1 sgRNA CRISPR Lentivector set (Mouse)
K4790001	ABM	3 x 1.0 ug	EUR 339

Mxi1 sgRNA CRISPR Lentivector set (Rat)
K6820501	ABM	3 x 1.0 ug	EUR 339

MXI1 sgRNA CRISPR Lentivector set (Human)
K1370201	ABM	3 x 1.0 ug	EUR 339

Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4790002	ABM	1.0 ug DNA	EUR 154

Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4790003	ABM	1.0 ug DNA	EUR 154

Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4790004	ABM	1.0 ug DNA	EUR 154

Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6820502	ABM	1.0 ug DNA	EUR 154

Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6820503	ABM	1.0 ug DNA	EUR 154

Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6820504	ABM	1.0 ug DNA	EUR 154

MXI1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1370202	ABM	1.0 ug DNA	EUR 154

MXI1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1370203	ABM	1.0 ug DNA	EUR 154

MXI1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1370204	ABM	1.0 ug DNA	EUR 154

MXI1 Protein Vector (Mouse) (pPB-C-His)
PV203234	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPB-N-His)
PV203235	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-HA)
PV203236	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-His)
PV203237	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPB-C-His)
PV203238	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPB-N-His)
PV203239	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-HA)
PV203240	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-His)
PV203241	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPB-C-His)
PV203242	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPB-N-His)
PV203243	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-HA)
PV203244	ABM	500 ng	EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-His)
PV203245	ABM	500 ng	EUR 603

MXI1 Protein Vector (Rat) (pPB-C-His)
PV283798	ABM	500 ng	EUR 603

MXI1 Protein Vector (Rat) (pPB-N-His)
PV283799	ABM	500 ng	EUR 603

MXI1 Protein Vector (Rat) (pPM-C-HA)
PV283800	ABM	500 ng	EUR 603

MXI1 Protein Vector (Rat) (pPM-C-His)
PV283801	ABM	500 ng	EUR 603

MXI1 Protein Vector (Human) (pPB-C-His)
PV027249	ABM	500 ng	EUR 329

MXI1 Protein Vector (Human) (pPB-N-His)
PV027250	ABM	500 ng	EUR 329

MXI1 Protein Vector (Human) (pPM-C-HA)
PV027251	ABM	500 ng	EUR 329

MXI1 Protein Vector (Human) (pPM-C-His)
PV027252	ABM	500 ng	EUR 329

MXI1 Protein Vector (Human) (pPB-C-His)
PV027253	ABM	500 ng	EUR 329

MXI1 Protein Vector (Human) (pPB-N-His)
PV027254	ABM	500 ng	EUR 329

MXI1 Protein Vector (Human) (pPM-C-HA)
PV027255	ABM	500 ng	EUR 329

MXI1 Protein Vector (Human) (pPM-C-His)
PV027256	ABM	500 ng	EUR 329

Human MAX Interactor 1(MXI1)ELISA Kit
QY-E04804	Qayee Biotechnology	96T	EUR 361

Mxi1 3'UTR Luciferase Stable Cell Line
TU113670	ABM	1.0 ml	Ask for price

Mxi1 3'UTR GFP Stable Cell Line
TU163670	ABM	1.0 ml	Ask for price

Mxi1 3'UTR Luciferase Stable Cell Line
TU213592	ABM	1.0 ml	Ask for price

Mxi1 3'UTR GFP Stable Cell Line
TU263592	ABM	1.0 ml	Ask for price

MXI1 3'UTR GFP Stable Cell Line
TU064996	ABM	1.0 ml	EUR 1521

MXI1 3'UTR Luciferase Stable Cell Line
TU014996	ABM	1.0 ml	EUR 1521

Human Max- interacting protein 1, MXI1 ELISA KIT
ELI-20014h	Lifescience Market	96 Tests	EUR 824

MXI1 Rabbit Polyclonal Antibody