LY96 Rabbit Polyclonal Antibody

LY96 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

LY96 Polyclonal Antibody
ABP59169-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human LY96 protein Applications tips:
Description: A polyclonal antibody for detection of LY96 from Human, Mouse. This LY96 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LY96 protein

LY96 Polyclonal Antibody
ABP59169-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LY96 protein Applications tips:
Description: A polyclonal antibody for detection of LY96 from Human, Mouse. This LY96 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LY96 protein

LY96 Polyclonal Antibody
ES11009-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LY96 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LY96 Polyclonal Antibody
ES11009-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LY96 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Lymphocyte Antigen 96 (LY96) ELISA Kit
DLR-LY96-Hu-48T	DL Develop	48T	EUR 463
Should the Human Lymphocyte Antigen 96 (LY96) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lymphocyte Antigen 96 (LY96) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lymphocyte Antigen 96 (LY96) ELISA Kit
DLR-LY96-Hu-96T	DL Develop	96T	EUR 599
Should the Human Lymphocyte Antigen 96 (LY96) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lymphocyte Antigen 96 (LY96) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lymphocyte Antigen 96 (LY96) ELISA Kit
RDR-LY96-Hu-48Tests	Reddot Biotech	48 Tests	EUR 481

Human Lymphocyte Antigen 96 (LY96) ELISA Kit
RDR-LY96-Hu-96Tests	Reddot Biotech	96 Tests	EUR 665

Human Lymphocyte Antigen 96 (LY96) ELISA Kit
RD-LY96-Hu-48Tests	Reddot Biotech	48 Tests	EUR 460

Human Lymphocyte Antigen 96 (LY96) ELISA Kit
RD-LY96-Hu-96Tests	Reddot Biotech	96 Tests	EUR 636

LY96 Rabbit pAb
A1866-100ul	Abclonal	100 ul	EUR 308

LY96 Rabbit pAb
A1866-200ul	Abclonal	200 ul	EUR 459

LY96 Rabbit pAb
A1866-20ul	Abclonal	20 ul	EUR 183

LY96 Rabbit pAb
A1866-50ul	Abclonal	50 ul	EUR 223

LY96 antibody
70R-18335	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LY96 antibody

LY96 antibody
70R-10270	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal LY96 antibody

LY96 Antibody
32480-100ul	SAB	100ul	EUR 252

LY96 Antibody
1-CSB-PA049918	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

LY96 Antibody
DF6669	Affbiotech	200ul	EUR 304
Description: LY96 Antibody detects endogenous levels of total LY96.

LY96 Antibody
1-CSB-PA013254ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LY96 Antibody
1-CSB-PA013254GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

LY96 Antibody
1-CSB-PA013254LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LY96 Antibody
ABD6669	Lifescience Market	100 ug	EUR 438

Polyclonal LY96 Antibody (C-term)
APR17258G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LY96 (C-term). This antibody is tested and proven to work in the following applications:

LY96 Polyclonal Antibody, Biotin Conjugated
A59695	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

LY96 Polyclonal Antibody, FITC Conjugated
A59696	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

LY96 Polyclonal Antibody, HRP Conjugated
A59697	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

LY96 Conjugated Antibody
C32480	SAB	100ul	EUR 397

anti- LY96 antibody
FNab04900	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:2000 IHC: 1:50-1:200 Immunogen: lymphocyte antigen 96 Uniprot ID: Q9Y6Y9 Gene ID: 23643 Research Area: Signal Transduction, Metabolism, Cancer, Immunology
Description: Antibody raised against LY96

Anti-LY96 antibody
PAab04900	Lifescience Market	100 ug	EUR 412

Anti-LY96 antibody
STJ24433	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-LY96 antibody
STJ192167	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LY96

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human)
4-PAH705Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Gln19~Asn160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96)

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse)
4-PAH705Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Thr16~Asn160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96)

LY96 siRNA
20-abx923156	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LY96 siRNA
20-abx923157	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LY96 Antibody, HRP conjugated
1-CSB-PA013254LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LY96 Antibody, FITC conjugated
1-CSB-PA013254LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LY96 Antibody, Biotin conjugated
1-CSB-PA013254LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), APC
4-PAH705Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Gln19~Asn160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with APC.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), Biotinylated
4-PAH705Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Gln19~Asn160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with Biotin.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), Cy3
4-PAH705Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Gln19~Asn160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with Cy3.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), FITC
4-PAH705Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Gln19~Asn160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with FITC.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), HRP
4-PAH705Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Gln19~Asn160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with HRP.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), PE
4-PAH705Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Gln19~Asn160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with PE.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), APC
4-PAH705Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Thr16~Asn160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with APC.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), Biotinylated
4-PAH705Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Thr16~Asn160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with Biotin.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), Cy3
4-PAH705Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Thr16~Asn160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with Cy3.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), FITC
4-PAH705Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Thr16~Asn160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with FITC.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), HRP
4-PAH705Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Thr16~Asn160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with HRP.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), PE
4-PAH705Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Thr16~Asn160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with PE.

LY96 Blocking Peptide
33R-6768	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LY96 antibody, catalog no. 70R-10270

LY96 Blocking Peptide
DF6669-BP	Affbiotech	1mg	EUR 195

LY96 cloning plasmid
CSB-CL013254HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 483 Sequence: atgttaccatttctgtttttttccaccctgttttcttccatatttactgaagctcagaagcagtattgggtctgcaactcatccgatgcaagtatttcatacacctactgtgataaaatgcaatacccaatttcaattaatgttaacccctgtatagaattgaaaggatccaaagg Show more
Description: A cloning plasmid for the LY96 gene.

pcDNA3.1-LY96 Plasmid
PVTB00381-2a	Lifescience Market	2 ug	EUR 356

Lymphocyte Antigen 96 (LY96) Antibody
20-abx212140	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody
20-abx102165	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Lymphocyte Antigen 96 (LY96) Antibody
20-abx102166	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Lymphocyte Antigen 96 (LY96) Antibody
20-abx113544	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody
20-abx173395	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Lymphocyte Antigen 96 (LY96) Antibody
abx029509-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody
abx029509-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody
20-abx320139	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody
abx234900-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Lymphocyte Antigen 96 (LY96) Antibody
20-abx304411	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody
20-abx225272	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody
20-abx001540	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), APC-Cy7
4-PAH705Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Gln19~Asn160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with APC-Cy7.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH705Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LY96 (Thr16~Asn160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with APC-Cy7.

Lymphocyte Antigen 96 (LY96) Antibody (Biotin)
20-abx272411	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Lymphocyte Antigen 96 (LY96) Antibody (Biotin)
20-abx272975	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Lymphocyte Antigen 96 (LY96) Antibody (HRP)
20-abx304412	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody (FITC)
20-abx304413	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody (Biotin)
20-abx304414	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

LY96 ELISA KIT|Human
EF010760	Lifescience Market	96 Tests	EUR 689

Human LY96 shRNA Plasmid
20-abx958417	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse LY96 shRNA Plasmid
20-abx971392	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LY96 Recombinant Protein (Human)
RP018451	ABM	100 ug	Ask for price

LY96 Recombinant Protein (Mouse)
RP148730	ABM	100 ug	Ask for price

LY96 Recombinant Protein (Mouse)
RP148733	ABM	100 ug	Ask for price

LY96 Recombinant Protein (Rat)
RP210383	ABM	100 ug	Ask for price

Human Lymphocyte antigen 96 (LY96)
1-CSB-EP013254HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 46.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Lymphocyte antigen 96(LY96),partial expressed in E.coli

Mouse Lymphocyte antigen 96 (Ly96)
1-CSB-EP013254MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 32.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 96(Ly96) expressed in E.coli

Mouse Lymphocyte antigen 96 (Ly96)
1-CSB-MP013254MO	Cusabio	EUR 293.00 EUR 963.00 EUR 409.00 EUR 717.00	100ug 1MG 200ug 500ug
MW: 20.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 96(Ly96) expressed in Mammalian cell

Ly96 ORF Vector (Rat) (pORF)
ORF070129	ABM	1.0 ug DNA	EUR 506

LY96 ORF Vector (Human) (pORF)
ORF006151	ABM	1.0 ug DNA	EUR 95

Ly96 ORF Vector (Mouse) (pORF)
ORF049578	ABM	1.0 ug DNA	EUR 506

Ly96 ORF Vector (Mouse) (pORF)
ORF049579	ABM	1.0 ug DNA	EUR 506

Recombinant Lymphocyte Antigen 96 (LY96)
4-RPH705Hu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Y6Y9 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.6kDa Isoelectric Point: 8.8
Description: Recombinant Human Lymphocyte Antigen 96 expressed in: E.coli

Recombinant Lymphocyte Antigen 96 (LY96)
4-RPH705Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9JHF9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.2kDa Isoelectric Point: 6.4
Description: Recombinant Mouse Lymphocyte Antigen 96 expressed in: E.coli

LY96 ELISA Kit (Human) (OKAN05795)
OKAN05795	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL

LY96 ELISA Kit (Human) (OKCD00545)
OKCD00545	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Binds bacterial lipopolysaccharide (LPS) (PubMed:17803912, PubMed:17569869). Cooperates with TLR4 in the innate immune response to bacterial lipopolysaccharide (LPS), and with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria (PubMed:11160242, PubMed:11593030). Enhances TLR4-dependent activation of NF-kappa-B (PubMed:10359581). Cells expressing both LY96 and TLR4, but not TLR4 alone, respond to LPS (PubMed:10359581).5 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4."_x005F_x005F_x000D_Shimazu R., Akashi S., Ogata H., Nagai Y., Fukudome K., Miyake K., Kimoto M._x005F_x005F_x000D_J. Exp. Med. 189:1777-1782(1999) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), VARIANT GLY-56, FUNCTION, INTERACTION WITH TLR4, SUBCELLULAR LOCATION.Ref.8"MD-2 enables Toll-like receptor 2 (TLR2)-mediated responses to lipopolysaccharide and enhances TLR2-mediated responses to Gram-positive and Gram-negative bacteria and their cell wall components."_x005F_x005F_x000D_Dziarski R., Wang Q., Miyake K., Kirschning C.J., Gupta D._x005F_x005F_x000D_J. Immunol. 166:1938-1944(2001) [PubMed] [Europe PMC] [Abstract]Cited for: INTERACTION WITH TLR2 AND TLR4, FUNCTION.Ref.9"Secreted MD-2 is a large polymeric protein that efficiently confers lipopolysaccharide sensitivity to Toll-like receptor 4."_x005F_x005F_x000D_Visintin A., Mazzoni A., Spitzer J.A., Segal D.M._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 98:12156-12161(2001) [PubMed] [Europe PMC] [Abstract]Cited for: DISULFIDE BONDS, GLYCOSYLATION, SUBCELLULAR LOCATION, FUNCTION, INTERACTION WITH TLR4.Ref.11"Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist Eritoran."_x005F_x005F_x000D_Kim H.M., Park B.S., Kim J.-I., Kim S.E., Lee J., Oh S.C., Enkhbayar P., Matsushima N., Lee H., Yoo O.J., Lee J.-O._x005F_x005F_x000D_Cell 130:906-917(2007) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.7 ANGSTROMS) OF 19-158 IN COMPLEX WITH TLR4 AND LIPOPOLYSACCHARIDE ANALOG, SUBUNIT.Ref.12"Crystal structures of human MD-2 and its complex with antiendotoxic lipid IVa."_x005F_x005F_x000D_Ohto U., Fukase K., Miyake K., Satow Y._x005F_x005F_x000D_Science 316:1632-1634(2007) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) OF 17-160 IN COMPLEX WITH LIPID IV-A, DISULFIDE BONDS, GLYCOSYLATION AT ASN-26 AND ASN-114. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.062 ng/mL

LY96 Rabbit Polyclonal Antibody