CDX4 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
 CDX4 Polyclonal Antibody |
|
ABP58099-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CDX4 from Human, Mouse. This CDX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110 |
CDX4 Polyclonal Antibody |
|
ABP58099-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CDX4 from Human, Mouse. This CDX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110 |
CDX4 Polyclonal Antibody |
|
ABP58099-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CDX4 from Human, Mouse. This CDX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110 |
 CDX4 Rabbit pAb |
|
A2704-100ul |
Abclonal |
100 ul |
EUR 308 |
CDX4 Rabbit pAb |
|
A2704-200ul |
Abclonal |
200 ul |
EUR 459 |
CDX4 Rabbit pAb |
|
A2704-20ul |
Abclonal |
20 ul |
EUR 183 |
CDX4 Rabbit pAb |
|
A2704-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal CDX4 Antibody (Center) |
|
AMM08762G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDX4 (Center). This antibody is tested and proven to work in the following applications: |
 CDX4 Antibody |
|
45262-100ul |
SAB |
100ul |
EUR 252 |
CDX4 Antibody |
|
45262-50ul |
SAB |
50ul |
EUR 187 |
CDX4 Antibody |
|
46947-100ul |
SAB |
100ul |
EUR 252 |
CDX4 Antibody |
|
DF8285 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CDX4 Antibody detects endogenous levels of total CDX4. |
CDX4 Antibody |
|
1-CSB-PA005129LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
) Polyclonal CDX4 Antibody (C-term) |
|
AMM08761G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDX4 (C-term). This antibody is tested and proven to work in the following applications: |
 Polyclonal Cdx4 antibody - C-terminal region |
|
AMM08763G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cdx4 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 CDX4 Conjugated Antibody |
|
C45262 |
SAB |
100ul |
EUR 397 |
CDX4 Conjugated Antibody |
|
C46947 |
SAB |
100ul |
EUR 397 |
 anti- CDX4 antibody |
|
FNab01574 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: caudal type homeobox 4
- Uniprot ID: O14627
- Gene ID: 1046
- Research Area: Epigenetics, Metabolism, Developmental biology
|
|
Description: Antibody raised against CDX4 |
 Anti-CDX4 antibody |
|
STJ116185 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of a small subfamily of homeobox containing transcription factors. The encoded protein may regulate homeobox gene expression during anteroposterior patterning and hematopoiesis. |
Anti-CDX4 antibody |
|
STJ192425 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CDX4 |
 CDX4 siRNA |
|
20-abx911366 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDX4 siRNA |
|
20-abx911367 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CDX4 Antibody, HRP conjugated |
|
1-CSB-PA005129LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 CDX4 Antibody, FITC conjugated |
|
1-CSB-PA005129LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 CDX4 Antibody, Biotin conjugated |
|
1-CSB-PA005129LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 CDX4 cloning plasmid |
|
CSB-CL005129HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 855
- Sequence: ATGTACGGAAGCTGTCTTTTGGAGAAAGAAGCAGGCATGTACCCGGGCACTCTCATGAGCCCTGGGGGCGACGGCACAGCTGGGACAGGCGGCACAGGGGGCGGTGGGAGTCCGATGCCAGCCTCCAATTTCGCTGCGGCACCGGCTTTCTCGCACTATATGGGGTATCCTCATAT
- Show more
|
|
Description: A cloning plasmid for the CDX4 gene. |
 CDX4 Blocking Peptide |
|
DF8285-BP |
Affbiotech |
1mg |
EUR 195 |
) Anti-Cdx4 (1G12) |
|
YF-MA12403 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (1G12) |
|
YF-MA12404 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (1H7) |
|
YF-MA12405 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (2E11) |
|
YF-MA12406 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (2G12) |
|
YF-MA12407 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (3H3) |
|
YF-MA12408 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (3F3) |
|
YF-MA12409 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (1A11) |
|
YF-MA12410 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (2F8) |
|
YF-MA12411 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (3H8) |
|
YF-MA12412 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (1H4) |
|
YF-MA12413 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (2H7) |
|
YF-MA12414 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (1E9) |
|
YF-MA12415 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (3F11) |
|
YF-MA12416 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
) Anti-Cdx4 (1E11) |
|
YF-MA12417 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Cdx4 |
 Human CDX4 shRNA Plasmid |
|
20-abx950755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse CDX4 shRNA Plasmid |
|
20-abx969634 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CDX4 Recombinant Protein (Human) |
|
RP037975 |
ABM |
100 ug |
Ask for price |
) CDX4 Recombinant Protein (Rat) |
|
RP194420 |
ABM |
100 ug |
Ask for price |
) CDX4 Recombinant Protein (Mouse) |
|
RP123266 |
ABM |
100 ug |
Ask for price |
 Antibody) Homeobox Protein CDX-4 (CDX4) Antibody |
|
20-abx149178 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Homeobox Protein CDX-4 (CDX4) Antibody |
|
20-abx005973 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Homeobox Protein CDX-4 (CDX4) Antibody |
|
20-abx318143 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody) Caudal Type Homeobox 4 (CDX4) Antibody |
|
abx231574-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 polyclonal antibody) Caudal type homeo box transcription factor 4 (CDX4) polyclonal antibody |
|
ABP-PAB-10470 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Transcription Factors
- Brand:
|
 (M06), Clone: 3F3) Monoclonal CDX4 Antibody (monoclonal) (M06), Clone: 3F3 |
|
APR15399G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human CDX4 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3F3. This antibody is applicable in WB, E |
 (M08), Clone: 2F8) Monoclonal CDX4 Antibody (monoclonal) (M08), Clone: 2F8 |
|
APR15400G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human CDX4 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2F8. This antibody is applicable in WB, E |
 Antibody (HRP)) Homeobox Protein CDX-4 (CDX4) Antibody (HRP) |
|
20-abx315635 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Homeobox Protein CDX-4 (CDX4) Antibody (FITC) |
|
20-abx315636 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Homeobox Protein CDX-4 (CDX4) Antibody (Biotin) |
|
20-abx315637 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Cdx4 ORF Vector (Mouse) (pORF) |
|
ORF041090 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) CDX4 ORF Vector (Human) (pORF) |
|
ORF012659 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Cdx4 ORF Vector (Rat) (pORF) |
|
ORF064808 |
ABM |
1.0 ug DNA |
EUR 506 |
) CDX4 sgRNA CRISPR Lentivector set (Human) |
|
K0423601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cdx4 sgRNA CRISPR Lentivector set (Mouse) |
|
K3909601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cdx4 sgRNA CRISPR Lentivector set (Rat) |
|
K6479101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) CDX4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0423602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CDX4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0423603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CDX4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0423604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3909602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3909603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3909604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6479102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6479103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6479104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CDX4 Protein Vector (Human) (pPB-C-His) |
|
PV050633 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) CDX4 Protein Vector (Human) (pPB-N-His) |
|
PV050634 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) CDX4 Protein Vector (Human) (pPM-C-HA) |
|
PV050635 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) CDX4 Protein Vector (Human) (pPM-C-His) |
|
PV050636 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) CDX4 Protein Vector (Rat) (pPB-C-His) |
|
PV259230 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CDX4 Protein Vector (Rat) (pPB-N-His) |
|
PV259231 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CDX4 Protein Vector (Rat) (pPM-C-HA) |
|
PV259232 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CDX4 Protein Vector (Rat) (pPM-C-His) |
|
PV259233 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CDX4 Protein Vector (Mouse) (pPB-C-His) |
|
PV164358 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CDX4 Protein Vector (Mouse) (pPB-N-His) |
|
PV164359 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CDX4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV164360 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CDX4 Protein Vector (Mouse) (pPM-C-His) |
|
PV164361 |
ABM |
500 ng |
EUR 603 |
 Cdx4 3'UTR Luciferase Stable Cell Line |
|
TU202134 |
ABM |
1.0 ml |
Ask for price |
 Cdx4 3'UTR GFP Stable Cell Line |
|
TU153671 |
ABM |
1.0 ml |
Ask for price |
 CDX4 3'UTR Luciferase Stable Cell Line |
|
TU004126 |
ABM |
1.0 ml |
EUR 1394 |
Cdx4 3'UTR Luciferase Stable Cell Line |
|
TU103671 |
ABM |
1.0 ml |
Ask for price |
 CDX4 3'UTR GFP Stable Cell Line |
|
TU054126 |
ABM |
1.0 ml |
EUR 1394 |
Cdx4 3'UTR GFP Stable Cell Line |
|
TU252134 |
ABM |
1.0 ml |
Ask for price |
 Human Homeobox protein CDX- 4, CDX4 ELISA KIT |
|
ELI-25465h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Homeobox protein CDX- 4, Cdx4 ELISA KIT |
|
ELI-33837m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Human Homeobox Protein CDX-4 (CDX4) ELISA Kit |
|
abx386449-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CDX4 Rabbit Polyclonal Antibody
