CDX4 Rabbit Polyclonal Antibody

CDX4 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

CDX4 Polyclonal Antibody
ABP58099-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CDX4 from Human, Mouse. This CDX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110

CDX4 Polyclonal Antibody
ES11267-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CDX4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDX4 Polyclonal Antibody
ES11267-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CDX4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDX4 Rabbit pAb
A2704-100ul 100 ul
EUR 308

CDX4 Rabbit pAb
A2704-200ul 200 ul
EUR 459

CDX4 Rabbit pAb
A2704-20ul 20 ul
EUR 183

CDX4 Rabbit pAb
A2704-50ul 50 ul
EUR 223

Polyclonal CDX4 Antibody (Center)
AMM08762G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDX4 (Center). This antibody is tested and proven to work in the following applications:

CDX4 Antibody
46947-100ul 100ul
EUR 252

CDX4 Antibody
45262-100ul 100ul
EUR 252

CDX4 Antibody
45262-50ul 50ul
EUR 187

CDX4 Antibody
1-CSB-PA005129LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

CDX4 Antibody
DF8285 200ul
EUR 304
Description: CDX4 Antibody detects endogenous levels of total CDX4.

CDX4 Antibody
ABD8285 100 ug
EUR 438

Polyclonal CDX4 Antibody (C-term)
AMM08761G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDX4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Cdx4 antibody - C-terminal region
AMM08763G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cdx4 - C-terminal region. This antibody is tested and proven to work in the following applications:

CDX4 Conjugated Antibody
C45262 100ul
EUR 397

CDX4 Conjugated Antibody
C46947 100ul
EUR 397

anti- CDX4 antibody
FNab01574 100µg
EUR 505.25
  • Immunogen: caudal type homeobox 4
  • Uniprot ID: O14627
  • Gene ID: 1046
  • Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against CDX4

Anti-CDX4 antibody
PAab01574 100 ug
EUR 355

Anti-CDX4 antibody
STJ116185 100 µl
EUR 277
Description: This gene encodes a member of a small subfamily of homeobox containing transcription factors. The encoded protein may regulate homeobox gene expression during anteroposterior patterning and hematopoiesis.

Anti-CDX4 antibody
STJ192425 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CDX4

CDX4 siRNA
20-abx911366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDX4 siRNA
20-abx911367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDX4 Antibody, HRP conjugated
1-CSB-PA005129LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDX4 Antibody, FITC conjugated
1-CSB-PA005129LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDX4 Antibody, Biotin conjugated
1-CSB-PA005129LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CDX4 Blocking Peptide
DF8285-BP 1mg
EUR 195

CDX4 cloning plasmid
CSB-CL005129HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 855
  • Sequence: ATGTACGGAAGCTGTCTTTTGGAGAAAGAAGCAGGCATGTACCCGGGCACTCTCATGAGCCCTGGGGGCGACGGCACAGCTGGGACAGGCGGCACAGGGGGCGGTGGGAGTCCGATGCCAGCCTCCAATTTCGCTGCGGCACCGGCTTTCTCGCACTATATGGGGTATCCTCATAT
  • Show more
Description: A cloning plasmid for the CDX4 gene.

Anti-Cdx4 (1G12)
YF-MA12403 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1G12)
YF-MA12404 200 ul
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1H7)
YF-MA12405 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (2E11)
YF-MA12406 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (2G12)
YF-MA12407 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (3H3)
YF-MA12408 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (3F3)
YF-MA12409 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1A11)
YF-MA12410 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (2F8)
YF-MA12411 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (3H8)
YF-MA12412 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1H4)
YF-MA12413 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (2H7)
YF-MA12414 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1E9)
YF-MA12415 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (3F11)
YF-MA12416 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

Anti-Cdx4 (1E11)
YF-MA12417 100 ug
EUR 363
Description: Mouse monoclonal to Cdx4

CDX4 ELISA KIT|Human
EF008580 96 Tests
EUR 689

Mouse CDX4 shRNA Plasmid
20-abx969634
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CDX4 shRNA Plasmid
20-abx950755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDX4 Recombinant Protein (Human)
RP037975 100 ug Ask for price

CDX4 Recombinant Protein (Rat)
RP194420 100 ug Ask for price

CDX4 Recombinant Protein (Mouse)
RP123266 100 ug Ask for price

Homeobox Protein CDX-4 (CDX4) Antibody
20-abx005973
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Homeobox Protein CDX-4 (CDX4) Antibody
20-abx149178
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Homeobox Protein CDX-4 (CDX4) Antibody
20-abx318143
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Caudal Type Homeobox 4 (CDX4) Antibody
abx231574-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Caudal type homeo box transcription factor 4 (CDX4) polyclonal antibody
ABP-PAB-10470 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

Monoclonal CDX4 Antibody (monoclonal) (M06), Clone: 3F3
APR15399G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CDX4 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3F3. This antibody is applicable in WB, E

Monoclonal CDX4 Antibody (monoclonal) (M08), Clone: 2F8
APR15400G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CDX4 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2F8. This antibody is applicable in WB, E

Homeobox Protein CDX-4 (CDX4) Antibody (HRP)
20-abx315635
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Homeobox Protein CDX-4 (CDX4) Antibody (FITC)
20-abx315636
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Homeobox Protein CDX-4 (CDX4) Antibody (Biotin)
20-abx315637
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cdx4 ORF Vector (Rat) (pORF)
ORF064808 1.0 ug DNA
EUR 506

CDX4 ORF Vector (Human) (pORF)
ORF012659 1.0 ug DNA
EUR 354

Cdx4 ORF Vector (Mouse) (pORF)
ORF041090 1.0 ug DNA
EUR 506

CDX4 sgRNA CRISPR Lentivector set (Human)
K0423601 3 x 1.0 ug
EUR 339

Cdx4 sgRNA CRISPR Lentivector set (Rat)
K6479101 3 x 1.0 ug
EUR 339

Cdx4 sgRNA CRISPR Lentivector set (Mouse)
K3909601 3 x 1.0 ug
EUR 339

CDX4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0423602 1.0 ug DNA
EUR 154

CDX4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0423603 1.0 ug DNA
EUR 154

CDX4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0423604 1.0 ug DNA
EUR 154

Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6479102 1.0 ug DNA
EUR 154

Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6479103 1.0 ug DNA
EUR 154

Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6479104 1.0 ug DNA
EUR 154

Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3909602 1.0 ug DNA
EUR 154

Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3909603 1.0 ug DNA
EUR 154

Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3909604 1.0 ug DNA
EUR 154

CDX4 Protein Vector (Mouse) (pPB-C-His)
PV164358 500 ng
EUR 603

CDX4 Protein Vector (Mouse) (pPB-N-His)
PV164359 500 ng
EUR 603

CDX4 Protein Vector (Mouse) (pPM-C-HA)
PV164360 500 ng
EUR 603

CDX4 Protein Vector (Mouse) (pPM-C-His)
PV164361 500 ng
EUR 603

CDX4 Protein Vector (Rat) (pPB-C-His)
PV259230 500 ng
EUR 603

CDX4 Protein Vector (Rat) (pPB-N-His)
PV259231 500 ng
EUR 603

CDX4 Protein Vector (Rat) (pPM-C-HA)
PV259232 500 ng
EUR 603

CDX4 Protein Vector (Rat) (pPM-C-His)
PV259233 500 ng
EUR 603

CDX4 Protein Vector (Human) (pPB-C-His)
PV050633 500 ng
EUR 481

CDX4 Protein Vector (Human) (pPB-N-His)
PV050634 500 ng
EUR 481

CDX4 Protein Vector (Human) (pPM-C-HA)
PV050635 500 ng
EUR 481

CDX4 Protein Vector (Human) (pPM-C-His)
PV050636 500 ng
EUR 481

Cdx4 3'UTR GFP Stable Cell Line
TU153671 1.0 ml Ask for price

Cdx4 3'UTR Luciferase Stable Cell Line
TU103671 1.0 ml Ask for price

Cdx4 3'UTR Luciferase Stable Cell Line
TU202134 1.0 ml Ask for price

Cdx4 3'UTR GFP Stable Cell Line
TU252134 1.0 ml Ask for price

CDX4 3'UTR GFP Stable Cell Line
TU054126 1.0 ml
EUR 1394

CDX4 3'UTR Luciferase Stable Cell Line
TU004126 1.0 ml
EUR 1394

Human Homeobox protein CDX- 4, CDX4 ELISA KIT
ELI-25465h 96 Tests
EUR 824

Human Homeobox Protein CDX-4 (CDX4) ELISA Kit
abx386449-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Homeobox protein CDX- 4, Cdx4 ELISA KIT
ELI-33837m 96 Tests
EUR 865

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

CDX4 Rabbit Polyclonal Antibody

Apex Business WordPress Theme | Designed by Crafthemes