NRG4 Rabbit Polyclonal Antibody
NRG4 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
NRG4 Polyclonal Antibody |
ES11386-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NRG4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NRG4 Polyclonal Antibody |
ABP59535-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
- Applications tips:
|
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60 |
NRG4 Polyclonal Antibody |
ABP59535-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
- Applications tips:
|
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60 |
NRG4 Polyclonal Antibody |
ABP59535-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
- Applications tips:
|
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60 |
NRG4 Polyclonal Antibody |
A64124 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Human Neuregulin 4 (NRG4) ELISA Kit |
DLR-NRG4-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Neuregulin 4 (NRG4) ELISA Kit |
DLR-NRG4-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
DLR-NRG4-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
DLR-NRG4-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Neuregulin 4 (NRG4) ELISA Kit |
RD-NRG4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Neuregulin 4 (NRG4) ELISA Kit |
RD-NRG4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
RD-NRG4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
RD-NRG4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Neuregulin 4 (NRG4) ELISA Kit |
RDR-NRG4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Neuregulin 4 (NRG4) ELISA Kit |
RDR-NRG4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
RDR-NRG4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
RDR-NRG4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
NRG4 Rabbit pAb |
A2599-100ul |
Abclonal |
100 ul |
EUR 308 |
NRG4 Rabbit pAb |
A2599-200ul |
Abclonal |
200 ul |
EUR 459 |
NRG4 Rabbit pAb |
A2599-20ul |
Abclonal |
20 ul |
EUR 183 |
NRG4 Rabbit pAb |
A2599-50ul |
Abclonal |
50 ul |
EUR 223 |
NRG4 Antibody |
36182-100ul |
SAB |
100ul |
EUR 252 |
NRG4 antibody |
38430-100ul |
SAB |
100ul |
EUR 252 |
NRG4 antibody |
70R-18964 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NRG4 antibody |
NRG4 Antibody |
DF7046 |
Affbiotech |
200ul |
EUR 304 |
Description: NRG4 Antibody detects endogenous levels of total NRG4. |
NRG4 Antibody |
1-CSB-PA278214 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
NRG4 Antibody |
1-CSB-PA10569A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
NRG4 Antibody |
1-CSB-PA016080GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
NRG4 Polyclonal Antibody, HRP Conjugated |
A64125 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
NRG4 Polyclonal Antibody, FITC Conjugated |
A64126 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NRG4 Polyclonal Antibody, Biotin Conjugated |
A64127 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Neuregulin 4 (NRG4) Polyclonal Antibody (Human) |
4-PAC174Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Phe62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4) |
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse) |
4-PAC174Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Ser62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4) |
NRG4 Conjugated Antibody |
C36182 |
SAB |
100ul |
EUR 397 |
Anti-NRG4 antibody |
STJ192544 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NRG4 |
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), APC |
4-PAC174Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Phe62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), Biotinylated |
4-PAC174Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Phe62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Biotin. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), Cy3 |
4-PAC174Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Phe62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Cy3. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), FITC |
4-PAC174Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Phe62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with FITC. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), HRP |
4-PAC174Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Phe62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with HRP. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), PE |
4-PAC174Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Phe62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with PE. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), APC |
4-PAC174Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Ser62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with APC. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC174Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Ser62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with Biotin. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), Cy3 |
4-PAC174Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Ser62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with Cy3. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), FITC |
4-PAC174Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Ser62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with FITC. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), HRP |
4-PAC174Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Ser62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with HRP. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), PE |
4-PAC174Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Ser62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with PE. |
Rabbit Neuregulin 4 (NRG4) ELISA Kit |
abx362372-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
NRG4 siRNA |
20-abx926394 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRG4 siRNA |
20-abx926395 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NRG4 |
YF-PA22379 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to NRG4 |
anti-NRG4 |
YF-PA27668 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NRG4 |
Neuregulin-4 (Nrg4) Antibody |
20-abx114064 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuregulin 4 (NRG4) Antibody |
20-abx128608 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuregulin 4 (NRG4) Antibody |
20-abx129434 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuregulin 4 (NRG4) Antibody |
20-abx121652 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Neuregulin 4 (NRG4) Antibody |
20-abx002032 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Neuregulin 4 (NRG4) Antibody |
20-abx132300 |
Abbexa |
-
EUR 495.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 154.00
-
EUR 342.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuregulin 4 (NRG4) Antibody |
20-abx173755 |
Abbexa |
|
|
|
Neuregulin 4 (NRG4) Antibody |
20-abx177746 |
Abbexa |
|
|
|
Neuregulin 4 (NRG4) Antibody |
20-abx301982 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuregulin 4 (NRG4) Antibody |
20-abx212234 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRG4 Antibody, HRP conjugated |
1-CSB-PA10569B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NRG4 Antibody, FITC conjugated |
1-CSB-PA10569C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NRG4 Antibody, Biotin conjugated |
1-CSB-PA10569D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC174Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Phe62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7. |
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC174Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRG4 (Met1~Ser62)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7. |
NRG4 Blocking Peptide |
DF7046-BP |
Affbiotech |
1mg |
EUR 195 |
NRG4 cloning plasmid |
CSB-CL848829HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 348
- Sequence: atgccaacagatcacgaagagccctgtggtcccagtcacaagtcgttttgcctgaatggggggctttgttatgtgatacctactattcccagcccattttgtaggtgcgttgaaaactatacaggagctcgttgtgaagaggtttttctcccaggctccagcatccaaactaaaag
- Show more
|
Description: A cloning plasmid for the NRG4 gene. |
NRG4, Human Recombinant |
P1580-10 |
Biovision |
10 µg |
EUR 196 |
Neuregulin 4 (NRG4) Antibody (HRP) |
20-abx306456 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuregulin 4 (NRG4) Antibody (FITC) |
20-abx306457 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuregulin 4 (NRG4) Antibody (Biotin) |
20-abx306458 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuregulin 4 (NRG4) Antibody Pair |
20-abx370478 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Neuregulin 4 (NRG4) Monoclonal Antibody (Human) |
4-MAC174Hu21 |
Cloud-Clone |
-
EUR 289.00
-
EUR 3170.00
-
EUR 775.00
-
EUR 370.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Phe62
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4) |
Mouse NRG4 shRNA Plasmid |
20-abx979171 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NRG4 shRNA Plasmid |
20-abx965452 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NRG4 protein (His tag) |
80R-3605 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant NRG4 protein (His tag) |
Recombinant Neuregulin 4 (NRG4) |
4-RPC174Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8WWG1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 39.2kDa
- Isoelectric Point: 6.2
|
Description: Recombinant Human Neuregulin 4 expressed in: E.coli |
Recombinant Neuregulin 4 (NRG4) |
4-RPC174Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9WTX4
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 10.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Neuregulin 4 expressed in: E.coli |
Mouse NRG4 ELISA Kit |
STJ150270 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of NRG-4 in Mouse serum, plasma and other biological fluids |
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), APC |
4-MAC174Hu21-APC |
Cloud-Clone |
-
EUR 408.00
-
EUR 4175.00
-
EUR 1137.00
-
EUR 530.00
-
EUR 246.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Phe62
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC. |
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), Biotinylated |
4-MAC174Hu21-Biotin |
Cloud-Clone |
-
EUR 357.00
-
EUR 3120.00
-
EUR 892.00
-
EUR 447.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Phe62
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Biotin. |
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), Cy3 |
4-MAC174Hu21-Cy3 |
Cloud-Clone |
-
EUR 503.00
-
EUR 5525.00
-
EUR 1475.00
-
EUR 665.00
-
EUR 287.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Phe62
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Cy3. |
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), FITC |
4-MAC174Hu21-FITC |
Cloud-Clone |
-
EUR 346.00
-
EUR 3360.00
-
EUR 930.00
-
EUR 444.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Phe62
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with FITC. |
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), HRP |
4-MAC174Hu21-HRP |
Cloud-Clone |
-
EUR 370.00
-
EUR 3635.00
-
EUR 1002.00
-
EUR 476.00
-
EUR 230.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Phe62
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with HRP. |
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), PE |
4-MAC174Hu21-PE |
Cloud-Clone |
-
EUR 346.00
-
EUR 3360.00
-
EUR 930.00
-
EUR 444.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Phe62
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with PE. |
Mouse Neuregulin 4 (NRG4) Protein |
20-abx167365 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuregulin 4 (NRG4) Blocking Peptide |
20-abx162626 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Neuregulin 4 (NRG4) Protein |
20-abx166554 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Neuregulin 4 (NRG4) Protein |
20-abx262416 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
NRG4 ORF Vector (Human) (pORF) |
ORF007218 |
ABM |
1.0 ug DNA |
EUR 95 |
Nrg4 ORF Vector (Rat) (pORF) |
ORF071514 |
ABM |
1.0 ug DNA |
EUR 506 |
Nrg4 ORF Vector (Mouse) (pORF) |
ORF051675 |
ABM |
1.0 ug DNA |
EUR 506 |
NRG4 ELISA Kit (Human) (OKCD01642) |
OKCD01642 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL |
Nrg4 ELISA Kit (Mouse) (OKCD01643) |
OKCD01643 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL |
NRG4 ELISA Kit (Human) (OKAN06417) |
OKAN06417 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The neuregulins, including NRG4, activate type-1 growth factor receptors (see EGFR; MIM 131550) to initiating cell-to-cell signaling through tyrosine phosphorylation (Harari et al., 1999 [PubMed 10348342]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
NRG4 ELISA Kit (Mouse) (OKEI00350) |
OKEI00350 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), APC-Cy7 |
4-MAC174Hu21-APC-Cy7 |
Cloud-Clone |
-
EUR 697.00
-
EUR 8230.00
-
EUR 2155.00
-
EUR 940.00
-
EUR 373.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Phe62
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7. |
Pig Neuregulin 4 (NRG4) ELISA Kit |
abx361378-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Neuregulin 4 (NRG4) ELISA Kit |
20-abx154449 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Neuregulin 4 (NRG4) ELISA Kit |
20-abx152489 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Chicken Neuregulin 4 (NRG4) ELISA Kit |
abx356190-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Neuregulin 4 (NRG4) ELISA Kit |
abx359592-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Neuregulin 4 (NRG4) CLIA Kit |
20-abx493518 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Neuregulin 4 (NRG4) CLIA Kit |
20-abx493519 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Neuregulin 4 (NRG4) ELISA Kit |
abx252831-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse Neuregulin 4 (NRG4) ELISA Kit |
abx254297-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
NRG4 sgRNA CRISPR Lentivector set (Human) |
K1455101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nrg4 sgRNA CRISPR Lentivector set (Mouse) |
K4512801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human neuregulin-4 (NRG4) ELISA kit |
CSB-EL016080HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human neuregulin-4 (NRG4) ELISA kit |
1-CSB-EL016080HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse neuregulin-4 (NRG4) ELISA kit |
CSB-EL016080MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse neuregulin-4 (NRG4) ELISA kit |
1-CSB-EL016080MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Nrg4 sgRNA CRISPR Lentivector set (Rat) |
K6740101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Neuregulin 4 (NRG4) ELISA Kit |
SEC174Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neuregulin 4 (NRG4) ELISA Kit |
SEC174Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neuregulin 4 (NRG4) ELISA Kit |
SEC174Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neuregulin 4 (NRG4) ELISA Kit |
SEC174Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neuregulin 4 (NRG4) ELISA Kit |
4-SEC174Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuregulin 4 elisa. Alternative names of the recognized antigen: HRG4
- Pro-NRG4
- Pro-neuregulin-4, membrane-bound isoform
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuregulin 4 (NRG4) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
SEC174Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuregulin 4 (NRG4) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
SEC174Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuregulin 4 (NRG4) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
SEC174Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuregulin 4 (NRG4) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
SEC174Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuregulin 4 (NRG4) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuregulin 4 (NRG4) ELISA Kit |
4-SEC174Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuregulin 4 elisa. Alternative names of the recognized antigen: HRG4
- Pro-NRG4
- Pro-neuregulin-4, membrane-bound isoform
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Neuregulin 4 ELISA Kit (NRG4) |
RK01962 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Neuregulin 4 ELISA Kit (NRG4) |
RK03078 |
Abclonal |
96 Tests |
EUR 521 |
NRG4 Neuregulin-4 Human Recombinant Protein |
PROTQ8WWG1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: NRG4 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 84 amino acids (1-61 a.a.) and having a molecular mass of 9.1kDa. NRG4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
ELISA kit for Human NRG4 (Neuregulin 4) |
ELK3451 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuregulin 4 (NRG4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuregulin 4 (
- Show more
|
Description: A sandwich ELISA kit for detection of Neuregulin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse NRG4 (Neuregulin 4) |
ELK6927 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuregulin 4 (NRG4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuregulin 4 (
- Show more
|
Description: A sandwich ELISA kit for detection of Neuregulin 4 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
NRG4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1455102 |
ABM |
1.0 ug DNA |
EUR 154 |
NRG4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1455103 |
ABM |
1.0 ug DNA |
EUR 154 |
NRG4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1455104 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrg4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4512802 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrg4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4512803 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrg4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4512804 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrg4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6740102 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrg4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6740103 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrg4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6740104 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human NRG4 Protein, His, E.coli-10ug |
QP12880-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human NRG4 Protein, His, E.coli-1mg |
QP12880-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human NRG4 Protein, His, E.coli-2ug |
QP12880-2ug |
EnQuireBio |
2ug |
EUR 155 |
NRG4 Protein Vector (Human) (pPB-C-His) |
PV028869 |
ABM |
500 ng |
EUR 329 |
NRG4 Protein Vector (Human) (pPB-N-His) |
PV028870 |
ABM |
500 ng |
EUR 329 |
NRG4 Protein Vector (Human) (pPM-C-HA) |
PV028871 |
ABM |
500 ng |
EUR 329 |
NRG4 Protein Vector (Human) (pPM-C-His) |
PV028872 |
ABM |
500 ng |
EUR 329 |
NRG4 Protein Vector (Mouse) (pPB-C-His) |
PV206698 |
ABM |
500 ng |
EUR 603 |
NRG4 Protein Vector (Mouse) (pPB-N-His) |
PV206699 |
ABM |
500 ng |
EUR 603 |
NRG4 Protein Vector (Mouse) (pPM-C-HA) |
PV206700 |
ABM |
500 ng |
EUR 603 |
NRG4 Protein Vector (Mouse) (pPM-C-His) |
PV206701 |
ABM |
500 ng |
EUR 603 |
NRG4 Protein Vector (Rat) (pPB-C-His) |
PV286054 |
ABM |
500 ng |
EUR 603 |
NRG4 Protein Vector (Rat) (pPB-N-His) |
PV286055 |
ABM |
500 ng |
EUR 603 |
NRG4 Protein Vector (Rat) (pPM-C-HA) |
PV286056 |
ABM |
500 ng |
EUR 603 |
NRG4 Protein Vector (Rat) (pPM-C-His) |
PV286057 |
ABM |
500 ng |
EUR 603 |
Nrg4 3'UTR GFP Stable Cell Line |
TU164322 |
ABM |
1.0 ml |
Ask for price |
NRG4 3'UTR Luciferase Stable Cell Line |
TU015971 |
ABM |
1.0 ml |
EUR 1394 |
Nrg4 3'UTR Luciferase Stable Cell Line |
TU114322 |
ABM |
1.0 ml |
Ask for price |
NRG4 3'UTR GFP Stable Cell Line |
TU065971 |
ABM |
1.0 ml |
EUR 1394 |
Nrg4 3'UTR GFP Stable Cell Line |
TU264191 |
ABM |
1.0 ml |
Ask for price |
Nrg4 3'UTR Luciferase Stable Cell Line |
TU214191 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
NRG4 Rabbit Polyclonal Antibody