NRG4 Rabbit Polyclonal Antibody

NRG4 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

NRG4 Polyclonal Antibody
ES11386-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NRG4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
NRG4 Polyclonal Antibody
ABP59535-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
NRG4 Polyclonal Antibody
ABP59535-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
NRG4 Polyclonal Antibody
ABP59535-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
NRG4 Polyclonal Antibody
A64124 100 µg
EUR 570.55
Description: Ask the seller for details
Human Neuregulin 4 (NRG4) ELISA Kit
DLR-NRG4-Hu-48T 48T
EUR 517
  • Should the Human Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Neuregulin 4 (NRG4) ELISA Kit
DLR-NRG4-Hu-96T 96T
EUR 673
  • Should the Human Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Neuregulin 4 (NRG4) ELISA Kit
DLR-NRG4-Mu-48T 48T
EUR 527
  • Should the Mouse Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Neuregulin 4 (NRG4) ELISA Kit
DLR-NRG4-Mu-96T 96T
EUR 688
  • Should the Mouse Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Neuregulin 4 (NRG4) ELISA Kit
RD-NRG4-Hu-48Tests 48 Tests
EUR 521
Human Neuregulin 4 (NRG4) ELISA Kit
RD-NRG4-Hu-96Tests 96 Tests
EUR 723
Mouse Neuregulin 4 (NRG4) ELISA Kit
RD-NRG4-Mu-48Tests 48 Tests
EUR 533
Mouse Neuregulin 4 (NRG4) ELISA Kit
RD-NRG4-Mu-96Tests 96 Tests
EUR 740
Human Neuregulin 4 (NRG4) ELISA Kit
RDR-NRG4-Hu-48Tests 48 Tests
EUR 544
Human Neuregulin 4 (NRG4) ELISA Kit
RDR-NRG4-Hu-96Tests 96 Tests
EUR 756
Mouse Neuregulin 4 (NRG4) ELISA Kit
RDR-NRG4-Mu-48Tests 48 Tests
EUR 557
Mouse Neuregulin 4 (NRG4) ELISA Kit
RDR-NRG4-Mu-96Tests 96 Tests
EUR 774
NRG4 Rabbit pAb
A2599-100ul 100 ul
EUR 308
NRG4 Rabbit pAb
A2599-200ul 200 ul
EUR 459
NRG4 Rabbit pAb
A2599-20ul 20 ul
EUR 183
NRG4 Rabbit pAb
A2599-50ul 50 ul
EUR 223
NRG4 Antibody
ABD7046 100 ug
EUR 438
NRG4 Antibody
36182-100ul 100ul
EUR 252
NRG4 antibody
38430-100ul 100ul
EUR 252
NRG4 antibody
70R-18964 50 ul
EUR 435
Description: Rabbit polyclonal NRG4 antibody
NRG4 Antibody
DF7046 200ul
EUR 304
Description: NRG4 Antibody detects endogenous levels of total NRG4.
NRG4 Antibody
1-CSB-PA278214
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
NRG4 Antibody
1-CSB-PA10569A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
NRG4 Antibody
1-CSB-PA016080GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
NRG4 Polyclonal Antibody, HRP Conjugated
A64125 100 µg
EUR 570.55
Description: The best epigenetics products
NRG4 Polyclonal Antibody, FITC Conjugated
A64126 100 µg
EUR 570.55
Description: kits suitable for this type of research
NRG4 Polyclonal Antibody, Biotin Conjugated
A64127 100 µg
EUR 570.55
Description: fast delivery possible
Neuregulin 4 (NRG4) Polyclonal Antibody (Human)
4-PAC174Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4)
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse)
4-PAC174Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4)
NRG4 Conjugated Antibody
C36182 100ul
EUR 397
Anti-NRG4 antibody
STJ24820 100 µl
EUR 277
Anti-NRG4 antibody
STJ192544 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NRG4
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), APC
4-PAC174Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC.
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), Biotinylated
4-PAC174Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Biotin.
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), Cy3
4-PAC174Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Cy3.
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), FITC
4-PAC174Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with FITC.
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), HRP
4-PAC174Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with HRP.
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), PE
4-PAC174Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with PE.
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), APC
4-PAC174Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with APC.
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), Biotinylated
4-PAC174Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with Biotin.
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), Cy3
4-PAC174Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with Cy3.
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), FITC
4-PAC174Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with FITC.
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), HRP
4-PAC174Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with HRP.
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), PE
4-PAC174Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with PE.
Rabbit Neuregulin 4 (NRG4) ELISA Kit
abx362372-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
NRG4 siRNA
20-abx926394
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NRG4 siRNA
20-abx926395
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-NRG4
YF-PA22379 100 ug
EUR 403
Description: Rabbit polyclonal to NRG4
anti-NRG4
YF-PA27668 50 ug
EUR 363
Description: Mouse polyclonal to NRG4
Neuregulin-4 (Nrg4) Antibody
20-abx114064
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Neuregulin 4 (NRG4) Antibody
20-abx128608
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Neuregulin 4 (NRG4) Antibody
20-abx129434
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Neuregulin 4 (NRG4) Antibody
20-abx121652
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Neuregulin 4 (NRG4) Antibody
20-abx002032
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Neuregulin 4 (NRG4) Antibody
20-abx132300
  • EUR 495.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 154.00
  • EUR 342.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Neuregulin 4 (NRG4) Antibody
20-abx173755
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Neuregulin 4 (NRG4) Antibody
20-abx177746
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Neuregulin 4 (NRG4) Antibody
20-abx301982
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuregulin 4 (NRG4) Antibody
20-abx212234
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
NRG4 Antibody, HRP conjugated
1-CSB-PA10569B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
NRG4 Antibody, FITC conjugated
1-CSB-PA10569C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
NRG4 Antibody, Biotin conjugated
1-CSB-PA10569D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Neuregulin 4 (NRG4) Polyclonal Antibody (Human), APC-Cy7
4-PAC174Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.
Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC174Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.
NRG4 Blocking Peptide
DF7046-BP 1mg
EUR 195
NRG4 cloning plasmid
CSB-CL848829HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 348
  • Sequence: atgccaacagatcacgaagagccctgtggtcccagtcacaagtcgttttgcctgaatggggggctttgttatgtgatacctactattcccagcccattttgtaggtgcgttgaaaactatacaggagctcgttgtgaagaggtttttctcccaggctccagcatccaaactaaaag
  • Show more
Description: A cloning plasmid for the NRG4 gene.
NRG4, Human Recombinant
P1580-10 10 µg
EUR 196
Neuregulin 4 (NRG4) Antibody (HRP)
20-abx306456
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuregulin 4 (NRG4) Antibody (FITC)
20-abx306457
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuregulin 4 (NRG4) Antibody (Biotin)
20-abx306458
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuregulin 4 (NRG4) Antibody Pair
20-abx370478
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.
Neuregulin 4 (NRG4) Monoclonal Antibody (Human)
4-MAC174Hu21
  • EUR 289.00
  • EUR 3170.00
  • EUR 775.00
  • EUR 370.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4)
Mouse NRG4 shRNA Plasmid
20-abx979171
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human NRG4 shRNA Plasmid
20-abx965452
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Nrg4 ELISA KIT
ELI-23788m 96 Tests
EUR 865
Human NRG4 ELISA KIT
ELI-44442h 96 Tests
EUR 824
NRG4 protein (His tag)
80R-3605 50 ug
EUR 424
Description: Purified recombinant NRG4 protein (His tag)
Recombinant Neuregulin 4 (NRG4)
4-RPC174Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WWG1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.2kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Neuregulin 4 expressed in: E.coli
Recombinant Neuregulin 4 (NRG4)
4-RPC174Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WTX4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 10.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Neuregulin 4 expressed in: E.coli
Mouse NRG4 ELISA Kit
STJ150270 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of NRG-4 in Mouse serum, plasma and other biological fluids
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), APC
4-MAC174Hu21-APC
  • EUR 408.00
  • EUR 4175.00
  • EUR 1137.00
  • EUR 530.00
  • EUR 246.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC.
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), Biotinylated
4-MAC174Hu21-Biotin
  • EUR 357.00
  • EUR 3120.00
  • EUR 892.00
  • EUR 447.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Biotin.
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), Cy3
4-MAC174Hu21-Cy3
  • EUR 503.00
  • EUR 5525.00
  • EUR 1475.00
  • EUR 665.00
  • EUR 287.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Cy3.
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), FITC
4-MAC174Hu21-FITC
  • EUR 346.00
  • EUR 3360.00
  • EUR 930.00
  • EUR 444.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with FITC.
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), HRP
4-MAC174Hu21-HRP
  • EUR 370.00
  • EUR 3635.00
  • EUR 1002.00
  • EUR 476.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with HRP.
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), PE
4-MAC174Hu21-PE
  • EUR 346.00
  • EUR 3360.00
  • EUR 930.00
  • EUR 444.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with PE.
Mouse Neuregulin 4 (NRG4) Protein
20-abx167365
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Neuregulin 4 (NRG4) Blocking Peptide
20-abx162626
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Human Neuregulin 4 (NRG4) Protein
20-abx166554
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Neuregulin 4 (NRG4) Protein
20-abx262416
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
NRG4 ORF Vector (Human) (pORF)
ORF007218 1.0 ug DNA
EUR 95
Nrg4 ORF Vector (Rat) (pORF)
ORF071514 1.0 ug DNA
EUR 506
Nrg4 ORF Vector (Mouse) (pORF)
ORF051675 1.0 ug DNA
EUR 506
NRG4 ELISA Kit (Human) (OKCD01642)
OKCD01642 96 Wells
EUR 831
Description: Description of target: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL
Nrg4 ELISA Kit (Mouse) (OKCD01643)
OKCD01643 96 Wells
EUR 857
Description: Description of target: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL
NRG4 ELISA Kit (Human) (OKAN06417)
OKAN06417 96 Wells
EUR 792
Description: Description of target: The neuregulins, including NRG4, activate type-1 growth factor receptors (see EGFR; MIM 131550) to initiating cell-to-cell signaling through tyrosine phosphorylation (Harari et al., 1999 [PubMed 10348342]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL
NRG4 ELISA Kit (Mouse) (OKEI00350)
OKEI00350 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL
Neuregulin 4 (NRG4) Monoclonal Antibody (Human), APC-Cy7
4-MAC174Hu21-APC-Cy7
  • EUR 697.00
  • EUR 8230.00
  • EUR 2155.00
  • EUR 940.00
  • EUR 373.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.
Pig Neuregulin 4 (NRG4) ELISA Kit
abx361378-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Neuregulin 4 (NRG4) ELISA Kit
20-abx154449
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Neuregulin 4 (NRG4) ELISA Kit
20-abx152489
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Chicken Neuregulin 4 (NRG4) ELISA Kit
abx356190-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Neuregulin 4 (NRG4) ELISA Kit
abx359592-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Neuregulin 4 (NRG4) CLIA Kit
20-abx493518
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Neuregulin 4 (NRG4) CLIA Kit
20-abx493519
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Neuregulin 4 (NRG4) ELISA Kit
abx252831-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Mouse Neuregulin 4 (NRG4) ELISA Kit
abx254297-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
NRG4 sgRNA CRISPR Lentivector set (Human)
K1455101 3 x 1.0 ug
EUR 339
Nrg4 sgRNA CRISPR Lentivector set (Mouse)
K4512801 3 x 1.0 ug
EUR 339
Human neuregulin-4 (NRG4) ELISA kit
CSB-EL016080HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human neuregulin-4 (NRG4) ELISA kit
1-CSB-EL016080HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse neuregulin-4 (NRG4) ELISA kit
CSB-EL016080MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse neuregulin-4 (NRG4) ELISA kit
1-CSB-EL016080MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Nrg4 sgRNA CRISPR Lentivector set (Rat)
K6740101 3 x 1.0 ug
EUR 339
Human Neuregulin 4 (NRG4) ELISA Kit
SEC174Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Neuregulin 4 (NRG4) ELISA Kit
SEC174Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Neuregulin 4 (NRG4) ELISA Kit
SEC174Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Neuregulin 4 (NRG4) ELISA Kit
SEC174Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Neuregulin 4 (NRG4) ELISA Kit
4-SEC174Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuregulin 4 elisa. Alternative names of the recognized antigen: HRG4
  • Pro-NRG4
  • Pro-neuregulin-4, membrane-bound isoform
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuregulin 4 (NRG4) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Neuregulin 4 (NRG4) ELISA Kit
SEC174Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuregulin 4 (NRG4) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Neuregulin 4 (NRG4) ELISA Kit
SEC174Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuregulin 4 (NRG4) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Neuregulin 4 (NRG4) ELISA Kit
SEC174Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuregulin 4 (NRG4) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Neuregulin 4 (NRG4) ELISA Kit
SEC174Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuregulin 4 (NRG4) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Neuregulin 4 (NRG4) ELISA Kit
4-SEC174Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuregulin 4 elisa. Alternative names of the recognized antigen: HRG4
  • Pro-NRG4
  • Pro-neuregulin-4, membrane-bound isoform
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Neuregulin 4 ELISA Kit (NRG4)
RK01962 96 Tests
EUR 521
Mouse Neuregulin 4 ELISA Kit (NRG4)
RK03078 96 Tests
EUR 521
NRG4 Neuregulin-4 Human Recombinant Protein
PROTQ8WWG1 Regular: 10ug
EUR 317
Description: NRG4 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 84 amino acids (1-61 a.a.) and having a molecular mass of 9.1kDa. NRG4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
ELISA kit for Human NRG4 (Neuregulin 4)
ELK3451 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuregulin 4 (NRG4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuregulin 4 (
  • Show more
Description: A sandwich ELISA kit for detection of Neuregulin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse NRG4 (Neuregulin 4)
ELK6927 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuregulin 4 (NRG4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuregulin 4 (
  • Show more
Description: A sandwich ELISA kit for detection of Neuregulin 4 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
NRG4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1455102 1.0 ug DNA
EUR 154
NRG4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1455103 1.0 ug DNA
EUR 154
NRG4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1455104 1.0 ug DNA
EUR 154
Nrg4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4512802 1.0 ug DNA
EUR 154
Nrg4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4512803 1.0 ug DNA
EUR 154
Nrg4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4512804 1.0 ug DNA
EUR 154
Nrg4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6740102 1.0 ug DNA
EUR 154
Nrg4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6740103 1.0 ug DNA
EUR 154
Nrg4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6740104 1.0 ug DNA
EUR 154
Recombinant Human NRG4 Protein, His, E.coli-10ug
QP12880-10ug 10ug
EUR 201
Recombinant Human NRG4 Protein, His, E.coli-1mg
QP12880-1mg 1mg
EUR 5251
Recombinant Human NRG4 Protein, His, E.coli-2ug
QP12880-2ug 2ug
EUR 155
NRG4 Protein Vector (Human) (pPB-C-His)
PV028869 500 ng
EUR 329
NRG4 Protein Vector (Human) (pPB-N-His)
PV028870 500 ng
EUR 329
NRG4 Protein Vector (Human) (pPM-C-HA)
PV028871 500 ng
EUR 329
NRG4 Protein Vector (Human) (pPM-C-His)
PV028872 500 ng
EUR 329
NRG4 Protein Vector (Mouse) (pPB-C-His)
PV206698 500 ng
EUR 603
NRG4 Protein Vector (Mouse) (pPB-N-His)
PV206699 500 ng
EUR 603
NRG4 Protein Vector (Mouse) (pPM-C-HA)
PV206700 500 ng
EUR 603
NRG4 Protein Vector (Mouse) (pPM-C-His)
PV206701 500 ng
EUR 603
NRG4 Protein Vector (Rat) (pPB-C-His)
PV286054 500 ng
EUR 603
NRG4 Protein Vector (Rat) (pPB-N-His)
PV286055 500 ng
EUR 603
NRG4 Protein Vector (Rat) (pPM-C-HA)
PV286056 500 ng
EUR 603
NRG4 Protein Vector (Rat) (pPM-C-His)
PV286057 500 ng
EUR 603
Nrg4 3'UTR GFP Stable Cell Line
TU164322 1.0 ml Ask for price
NRG4 3'UTR Luciferase Stable Cell Line
TU015971 1.0 ml
EUR 1394
Nrg4 3'UTR Luciferase Stable Cell Line
TU114322 1.0 ml Ask for price
NRG4 3'UTR GFP Stable Cell Line
TU065971 1.0 ml
EUR 1394
Nrg4 3'UTR GFP Stable Cell Line
TU264191 1.0 ml Ask for price
Nrg4 3'UTR Luciferase Stable Cell Line
TU214191 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

NRG4 Rabbit Polyclonal Antibody