KLK13 Rabbit Polyclonal Antibody
KLK13 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
KLK13 Polyclonal Antibody |
ABP59062-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein |
Human Kallikrein 13 (KLK13) ELISA Kit |
DLR-KLK13-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
DLR-KLK13-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
DLR-KLK13-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
DLR-KLK13-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
RD-KLK13-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Kallikrein 13 (KLK13) ELISA Kit |
RD-KLK13-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
RD-KLK13-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
RD-KLK13-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Kallikrein 13 (KLK13) ELISA Kit |
RDR-KLK13-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Kallikrein 13 (KLK13) ELISA Kit |
RDR-KLK13-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
RDR-KLK13-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
RDR-KLK13-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
KLK13 Rabbit pAb |
A14274-100ul |
Abclonal |
100 ul |
EUR 308 |
KLK13 Rabbit pAb |
A14274-200ul |
Abclonal |
200 ul |
EUR 459 |
KLK13 Rabbit pAb |
A14274-20ul |
Abclonal |
20 ul |
EUR 183 |
KLK13 Rabbit pAb |
A14274-50ul |
Abclonal |
50 ul |
EUR 223 |
KLK13 antibody |
70R-3265 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal KLK13 antibody raised against the middle region of KLK13 |
KLK13 Antibody |
36578-100ul |
SAB |
100ul |
EUR 252 |
KLK13 Antibody |
1-CSB-PA374084 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
KLK13 Antibody |
1-CSB-PA185718 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
Kallikrein 13 (KLK13) polyclonal antibody |
ABP-PAB-10239 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Kallikrein 13 (KLK13) Polyclonal Antibody (Human) |
4-PAD373Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13) |
KLK13 Conjugated Antibody |
C36578 |
SAB |
100ul |
EUR 397 |
Anti-KLK13 antibody |
STJ116486 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has been identified, but its full length sequence has not been determined. |
Anti-KLK13 antibody |
STJ192250 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to KLK13 |
Polyclonal KLK13 / Kallikrein 13 Antibody (aa262-277) |
APR02667G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLK13 / Kallikrein 13 (aa262-277). This antibody is tested and proven to work in the following applications: |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC |
4-PAD373Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Biotinylated |
4-PAD373Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Biotin. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Cy3 |
4-PAD373Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Cy3. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), FITC |
4-PAD373Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with FITC. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), HRP |
4-PAD373Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with HRP. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), PE |
4-PAD373Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with PE. |
KLK13 siRNA |
20-abx921819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KLK13 protein |
80R-4293 |
Fitzgerald |
20 ug |
EUR 327 |
Description: Purified Recombinant KLK13 protein (His tagged) |
Kallikrein 13 (KLK13) Antibody |
20-abx129211 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kallikrein 13 (KLK13) Antibody |
20-abx129912 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kallikrein 13 (KLK13) Antibody |
20-abx173224 |
Abbexa |
|
|
|
Kallikrein 13 (KLK13) Antibody |
20-abx177245 |
Abbexa |
|
|
|
Kallikrein 13 (KLK13) Antibody |
20-abx177246 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kallikrein 13 (KLK13) Antibody |
20-abx339236 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kallikrein 13 (KLK13) Antibody |
20-abx210856 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD373Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat) |
4-PAD373Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13) |
KLK13 Blocking Peptide |
33R-9689 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK13 antibody, catalog no. 70R-3265 |
KLK13 cloning plasmid |
CSB-CL891952HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 834
- Sequence: atgtggcccctggccctagtgatcgcctccctgaccttggccttgtcaggaggtgtctcccaggagtcttccaaggttctcaacaccaatgggaccagtgggtttctcccaggtggctacacctgcttcccccactctcagccctggcaggctgccctactagtgcaagggcggct
- Show more
|
Description: A cloning plasmid for the KLK13 gene. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC |
4-PAD373Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated |
4-PAD373Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Biotin. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Cy3 |
4-PAD373Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Cy3. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), FITC |
4-PAD373Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with FITC. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), HRP |
4-PAD373Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with HRP. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), PE |
4-PAD373Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with PE. |
Human KLK13 shRNA Plasmid |
20-abx958699 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KLK13 protein (His tag) |
80R-4083 |
Fitzgerald |
10 ug |
EUR 327 |
Description: Recombinant Human KLK13 protein (His tag) |
Recombinant Kallikrein 13 (KLK13) |
4-RPD373Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UKR3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Kallikrein 13 expressed in: E.coli |
Recombinant Kallikrein 13 (KLK13) |
4-RPD373Mu01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P36368
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Kallikrein 13 expressed in: E.coli |
KLK13 Recombinant Protein (Human) |
RP017230 |
ABM |
100 ug |
Ask for price |
KLK13 Recombinant Protein (Rat) |
RP207395 |
ABM |
100 ug |
Ask for price |
KLK13 Recombinant Protein (Mouse) |
RP146090 |
ABM |
100 ug |
Ask for price |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7 |
4-PAD373Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7. |
ELISA kit for Human KLK13 |
EK5504 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK13 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human KLK13 PicoKine ELISA Kit |
EK1168 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human KLK13 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA). |
Mouse Kallikrein 13 (KLK13) Protein |
20-abx168449 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Kallikrein 13 (KLK13) Protein |
20-abx167044 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
OVA conjugated Kallikrein 13 (KLK13) |
4-CPD373Hu21 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UKR3
- Buffer composition: PBS, pH 7.4.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Human Kallikrein 13 expressed in: chemical synthesis |
KLK13 ORF Vector (Human) (pORF) |
ORF005744 |
ABM |
1.0 ug DNA |
EUR 95 |
Klk13 ORF Vector (Rat) (pORF) |
ORF069133 |
ABM |
1.0 ug DNA |
EUR 506 |
Klk13 ORF Vector (Mouse) (pORF) |
ORF048698 |
ABM |
1.0 ug DNA |
EUR 506 |
KLK13 ELISA Kit (Human) (OKCD00765) |
OKCD00765 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.6 pg/mL |
KLK13 ELISA Kit (Human) (OKBB00909) |
OKBB00909 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Kallikrein-13 is a protein that in humans is encoded by the KLK13 gene. It belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. By genomic sequence analysis, KLK13 gene is mapped in a 300-kb region on chromosome 19q13.3-q13.4. It has been shown that recombinant hK13 produced in yeast can cleave synthetic peptides after the arginine residue and some extracellular matrix components. However, its exact physiological substrates and functions remain obscure. Despite the lack of knowledge on the physiological function of hK13, several studies have demonstrated that hK13 is implicated with cancer of the breast and ovary and it can serve as a favorable prognostic biomarker for these malignancies.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
20-abx154281 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Kallikrein 13 (KLK13) ELISA Kit |
20-abx152086 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Kallikrein 13 (KLK13) CLIA Kit |
20-abx494238 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Kallikrein 13 (KLK13) CLIA Kit |
20-abx494239 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
KLK13 sgRNA CRISPR Lentivector set (Human) |
K1160701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Klk13 sgRNA CRISPR Lentivector set (Mouse) |
K4322401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Klk13 sgRNA CRISPR Lentivector set (Rat) |
K6739401 |
ABM |
3 x 1.0 ug |
EUR 339 |
KLK13 Kallikrein-13 Human Recombinant Protein |
PROTQ9UKR3 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: KLK13 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 284 amino acids (17-277 a.a) and having a molecular mass of 31.3kDa.;KLK13 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Kallikrein 13 (KLK13) ELISA Kit |
SED373Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
SED373Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
SED373Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
SED373Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
4-SED373Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
- KLKL4
- Kallikrein-like protein 4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
SED373Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
SED373Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
SED373Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
SED373Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
4-SED373Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
- KLKL4
- Kallikrein-like protein 4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Recombinant Human Kallikrein 13/KLK13 (C-6His) |
C362-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 13/KLK13 (C-6His) |
C362-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 13/KLK13 (C-6His) |
C362-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 13/KLK13 (C-6His) |
C362-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
ELISA kit for Human KLK13 (Kallikrein 13) |
ELK4917 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
- Show more
|
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse KLK13 (Kallikrein 13) |
ELK7224 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
- Show more
|
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
KLK13 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1160702 |
ABM |
1.0 ug DNA |
EUR 154 |
KLK13 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1160703 |
ABM |
1.0 ug DNA |
EUR 154 |
KLK13 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1160704 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk13 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4322402 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk13 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4322403 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk13 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4322404 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk13 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6739402 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk13 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6739403 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk13 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6739404 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Human Kallikrein-13 (KLK13) |
KTE61899-48T |
Abbkine |
48T |
EUR 332 |
- Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kallikrein-13 (KLK13) |
KTE61899-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kallikrein-13 (KLK13) |
KTE61899-96T |
Abbkine |
96T |
EUR 539 |
- Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Recombinant Human KLK13 Protein, His, E.coli-1ug |
QP12503-1ug |
EnQuireBio |
1ug |
EUR 155 |
Recombinant Human KLK13 Protein, His, E.coli-50ug |
QP12503-50ug |
EnQuireBio |
50ug |
EUR 1261 |
Recombinant Human KLK13 Protein, His, E.coli-5ug |
QP12503-5ug |
EnQuireBio |
5ug |
EUR 201 |
Recombinant Human KLK13 Protein, His, Insect-1ug |
QP10737-1ug |
EnQuireBio |
1ug |
EUR 155 |
Recombinant Human KLK13 Protein, His, Insect-50ug |
QP10737-50ug |
EnQuireBio |
50ug |
EUR 1261 |
Recombinant Human KLK13 Protein, His, Insect-5ug |
QP10737-5ug |
EnQuireBio |
5ug |
EUR 201 |
KLK13 Protein Vector (Human) (pPB-C-His) |
PV022973 |
ABM |
500 ng |
EUR 329 |
KLK13 Protein Vector (Human) (pPB-N-His) |
PV022974 |
ABM |
500 ng |
EUR 329 |
KLK13 Protein Vector (Human) (pPM-C-HA) |
PV022975 |
ABM |
500 ng |
EUR 329 |
KLK13 Protein Vector (Human) (pPM-C-His) |
PV022976 |
ABM |
500 ng |
EUR 329 |
KLK13 Protein Vector (Rat) (pPB-C-His) |
PV276530 |
ABM |
500 ng |
EUR 603 |
KLK13 Protein Vector (Rat) (pPB-N-His) |
PV276531 |
ABM |
500 ng |
EUR 603 |
KLK13 Protein Vector (Rat) (pPM-C-HA) |
PV276532 |
ABM |
500 ng |
EUR 603 |
KLK13 Protein Vector (Rat) (pPM-C-His) |
PV276533 |
ABM |
500 ng |
EUR 603 |
KLK13 Protein Vector (Mouse) (pPB-C-His) |
PV194790 |
ABM |
500 ng |
EUR 603 |
KLK13 Protein Vector (Mouse) (pPB-N-His) |
PV194791 |
ABM |
500 ng |
EUR 603 |
KLK13 Protein Vector (Mouse) (pPM-C-HA) |
PV194792 |
ABM |
500 ng |
EUR 603 |
KLK13 Protein Vector (Mouse) (pPM-C-His) |
PV194793 |
ABM |
500 ng |
EUR 603 |
Klk13 3'UTR Luciferase Stable Cell Line |
TU206788 |
ABM |
1.0 ml |
Ask for price |
Klk13 3'UTR GFP Stable Cell Line |
TU160666 |
ABM |
1.0 ml |
Ask for price |
KLK13 3'UTR Luciferase Stable Cell Line |
TU011899 |
ABM |
1.0 ml |
EUR 1394 |
Klk13 3'UTR Luciferase Stable Cell Line |
TU110666 |
ABM |
1.0 ml |
Ask for price |
KLK13 3'UTR GFP Stable Cell Line |
TU061899 |
ABM |
1.0 ml |
EUR 1394 |
Klk13 3'UTR GFP Stable Cell Line |
TU256788 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
KLK13 Rabbit Polyclonal Antibody