FLRT2 Rabbit Polyclonal Antibody
FLRT2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
FLRT2 Polyclonal Antibody |
30115-50ul |
SAB |
50ul |
EUR 187 |
FLRT2 Polyclonal Antibody |
ABP58572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250 |
FLRT2 Polyclonal Antibody |
ABP58572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250 |
FLRT2 Polyclonal Antibody |
ABP58572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250 |
FLRT2 Polyclonal Antibody |
ES11281-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against FLRT2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FLRT2 Polyclonal Antibody |
ES11281-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against FLRT2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FLRT2 Rabbit pAb |
A17668-100ul |
Abclonal |
100 ul |
EUR 308 |
FLRT2 Rabbit pAb |
A17668-200ul |
Abclonal |
200 ul |
EUR 459 |
FLRT2 Rabbit pAb |
A17668-20ul |
Abclonal |
20 ul |
EUR 183 |
FLRT2 Rabbit pAb |
A17668-50ul |
Abclonal |
50 ul |
EUR 223 |
FLRT2 Polyclonal Conjugated Antibody |
C30115 |
SAB |
100ul |
EUR 397 |
Rabbit FLRT2 ELISA Kit |
ERTF0109 |
Abclonal |
96Tests |
EUR 521 |
Anti-FLRT2 antibody |
STJ119717 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016] |
Anti-FLRT2 antibody |
STJ192439 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FLRT2 |
FLRT2 siRNA |
20-abx916977 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FLRT2 cloning plasmid |
CSB-CL008730HU-10ug |
Cusabio |
10ug |
EUR 665 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1983
- Sequence: atgggcctacagaccacaaagtggcccagccatggggcttttttcctgaagtcttggcttatcatttccctggggctctactcacaggtgtccaaactcctggcctgccctagtgtgtgccgctgcgacaggaactttgtctactgtaatgagcgaagcttgacctcagtgcctc
- Show more
|
Description: A cloning plasmid for the FLRT2 gene. |
Human FLRT2 ELISA Kit |
EHF0109 |
Abclonal |
96Tests |
EUR 521 |
Goat FLRT2 ELISA Kit |
EGTF0109 |
Abclonal |
96Tests |
EUR 521 |
Bovine FLRT2 ELISA Kit |
EBF0109 |
Abclonal |
96Tests |
EUR 521 |
Canine FLRT2 ELISA Kit |
ECF0109 |
Abclonal |
96Tests |
EUR 521 |
Anserini FLRT2 ELISA Kit |
EAF0109 |
Abclonal |
96Tests |
EUR 521 |
Human FLRT2 shRNA Plasmid |
20-abx958456 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse FLRT2 ELISA Kit |
EMF0109 |
Abclonal |
96Tests |
EUR 521 |
Rat FLRT2 ELISA Kit |
ERF0109 |
Abclonal |
96Tests |
EUR 521 |
Porcine FLRT2 ELISA Kit |
EPF0109 |
Abclonal |
96Tests |
EUR 521 |
FLRT2 Recombinant Protein (Human) |
RP039232 |
ABM |
100 ug |
Ask for price |
FLRT2 Recombinant Protein (Rat) |
RP201539 |
ABM |
100 ug |
Ask for price |
FLRT2 Recombinant Protein (Mouse) |
RP134801 |
ABM |
100 ug |
Ask for price |
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human) |
4-PAC481Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) |
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC |
4-PAC481Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC. |
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Biotinylated |
4-PAC481Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Biotin. |
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Cy3 |
4-PAC481Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Cy3. |
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), FITC |
4-PAC481Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with FITC. |
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), HRP |
4-PAC481Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with HRP. |
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), PE |
4-PAC481Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with PE. |
Human FLRT2 PicoKine ELISA Kit |
EK1971 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA). |
Mouse FLRT2 PicoKine ELISA Kit |
EK1972 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA). |
Rat FLRT2 PicoKine ELISA Kit |
EK1973 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of rat FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA). |
Guinea Pig FLRT2 ELISA Kit |
EGF0109 |
Abclonal |
96Tests |
EUR 521 |
Flrt2 ORF Vector (Rat) (pORF) |
ORF067181 |
ABM |
1.0 ug DNA |
EUR 506 |
FLRT2 ORF Vector (Human) (pORF) |
ORF013078 |
ABM |
1.0 ug DNA |
EUR 354 |
Flrt2 ORF Vector (Mouse) (pORF) |
ORF044935 |
ABM |
1.0 ug DNA |
EUR 506 |
FLRT2 ELISA Kit (Human) (OKBB01345) |
OKBB01345 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 14q31.3. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Flrt2 ELISA Kit (Mouse) (OKBB01346) |
OKBB01346 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 12; 12 E. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Flrt2 ELISA Kit (Rat) (OKBB01347) |
OKBB01347 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 6q31. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
FLRT2 ELISA Kit (Human) (OKCA01329) |
OKCA01329 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells. May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D. Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members. Plays a role in fibroblast growth factor-mediated signaling cascades. Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 23.44 pg/mL |
FLRT2 ELISA Kit (Mouse) (OKEI00453) |
OKEI00453 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells . May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D . Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members . Plays a role in fibroblast growth factor-mediated signaling cascades . Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis .;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.875 ng/mL |
FLRT2 ELISA Kit (Rat) (OKEI00767) |
OKEI00767 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells. May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D. Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members. Plays a role in fibroblast growth factor-mediated signaling cascades. Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
Rabbit Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) ELISA Kit |
abx362800-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC481Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC-Cy7. |
Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Antibody |
20-abx131259 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Flrt2 sgRNA CRISPR Lentivector set (Rat) |
K6636201 |
ABM |
3 x 1.0 ug |
EUR 339 |
FLRT2 sgRNA CRISPR Lentivector set (Human) |
K0787901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Flrt2 sgRNA CRISPR Lentivector set (Mouse) |
K4147701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6636202 |
ABM |
1.0 ug DNA |
EUR 154 |
Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6636203 |
ABM |
1.0 ug DNA |
EUR 154 |
Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6636204 |
ABM |
1.0 ug DNA |
EUR 154 |
FLRT2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0787902 |
ABM |
1.0 ug DNA |
EUR 154 |
FLRT2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0787903 |
ABM |
1.0 ug DNA |
EUR 154 |
FLRT2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0787904 |
ABM |
1.0 ug DNA |
EUR 154 |
Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4147702 |
ABM |
1.0 ug DNA |
EUR 154 |
Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4147703 |
ABM |
1.0 ug DNA |
EUR 154 |
Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4147704 |
ABM |
1.0 ug DNA |
EUR 154 |
FLRT2 Protein Vector (Mouse) (pPB-C-His) |
PV179738 |
ABM |
500 ng |
EUR 603 |
FLRT2 Protein Vector (Mouse) (pPB-N-His) |
PV179739 |
ABM |
500 ng |
EUR 603 |
FLRT2 Protein Vector (Mouse) (pPM-C-HA) |
PV179740 |
ABM |
500 ng |
EUR 603 |
FLRT2 Protein Vector (Mouse) (pPM-C-His) |
PV179741 |
ABM |
500 ng |
EUR 603 |
FLRT2 Protein Vector (Rat) (pPB-C-His) |
PV268722 |
ABM |
500 ng |
EUR 603 |
FLRT2 Protein Vector (Rat) (pPB-N-His) |
PV268723 |
ABM |
500 ng |
EUR 603 |
FLRT2 Protein Vector (Rat) (pPM-C-HA) |
PV268724 |
ABM |
500 ng |
EUR 603 |
FLRT2 Protein Vector (Rat) (pPM-C-His) |
PV268725 |
ABM |
500 ng |
EUR 603 |
FLRT2 Protein Vector (Human) (pPB-C-His) |
PV052309 |
ABM |
500 ng |
EUR 481 |
FLRT2 Protein Vector (Human) (pPB-N-His) |
PV052310 |
ABM |
500 ng |
EUR 481 |
FLRT2 Protein Vector (Human) (pPM-C-HA) |
PV052311 |
ABM |
500 ng |
EUR 481 |
FLRT2 Protein Vector (Human) (pPM-C-His) |
PV052312 |
ABM |
500 ng |
EUR 481 |
Flrt2 3'UTR GFP Stable Cell Line |
TU156621 |
ABM |
1.0 ml |
Ask for price |
Flrt2 3'UTR Luciferase Stable Cell Line |
TU106621 |
ABM |
1.0 ml |
Ask for price |
Flrt2 3'UTR Luciferase Stable Cell Line |
TU204683 |
ABM |
1.0 ml |
Ask for price |
Flrt2 3'UTR GFP Stable Cell Line |
TU254683 |
ABM |
1.0 ml |
Ask for price |
FLRT2 3'UTR GFP Stable Cell Line |
TU058026 |
ABM |
1.0 ml |
EUR 2333 |
FLRT2 3'UTR Luciferase Stable Cell Line |
TU008026 |
ABM |
1.0 ml |
EUR 2333 |
FLRT2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV649033 |
ABM |
1.0 ug DNA |
EUR 682 |
FLRT2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV649037 |
ABM |
1.0 ug DNA |
EUR 682 |
FLRT2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV649038 |
ABM |
1.0 ug DNA |
EUR 682 |
Recombinant human Leucine-rich repeat transmembrane protein FLRT2 |
P1409 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: O43155
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Leucine-rich repeat transmembrane protein FLRT2 |
Recombinant Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) |
4-RPC481Hu01 |
Cloud-Clone |
-
EUR 352.67
-
EUR 197.00
-
EUR 1047.52
-
EUR 415.84
-
EUR 731.68
-
EUR 299.00
-
EUR 2468.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O43155
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Fibronectin Leucine Rich Transmembrane Protein 2 expressed in: E.coli |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
FLRT2 Rabbit Polyclonal Antibody