PAX3 Rabbit Polyclonal Antibody
PAX3 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
PAX3 Polyclonal Antibody |
ABP59838-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PAX3 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of PAX3 from Human, Mouse. This PAX3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAX3 protein at amino acid sequence of 150-230 |
PAX3 Polyclonal Antibody |
ABP59838-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PAX3 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of PAX3 from Human, Mouse. This PAX3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAX3 protein at amino acid sequence of 150-230 |
PAX3 Polyclonal Antibody |
ES11259-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PAX3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAX3 Polyclonal Antibody |
ES11259-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PAX3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAX3 Rabbit pAb |
A13930-100ul |
Abclonal |
100 ul |
EUR 308 |
PAX3 Rabbit pAb |
A13930-200ul |
Abclonal |
200 ul |
EUR 459 |
PAX3 Rabbit pAb |
A13930-20ul |
Abclonal |
20 ul |
EUR 183 |
PAX3 Rabbit pAb |
A13930-50ul |
Abclonal |
50 ul |
EUR 223 |
PAX3 Rabbit pAb |
A1675-100ul |
Abclonal |
100 ul |
EUR 308 |
PAX3 Rabbit pAb |
A1675-200ul |
Abclonal |
200 ul |
EUR 459 |
PAX3 Rabbit pAb |
A1675-20ul |
Abclonal |
20 ul |
EUR 183 |
PAX3 Rabbit pAb |
A1675-50ul |
Abclonal |
50 ul |
EUR 223 |
PAX3 antibody |
70R-19126 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PAX3 antibody |
PAX3 Antibody |
32380-100ul |
SAB |
100ul |
EUR 252 |
PAX3 antibody |
10R-1480 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal PAX3 antibody |
PAX3 Antibody |
DF6548 |
Affbiotech |
200ul |
EUR 304 |
Description: PAX3 Antibody detects endogenous levels of total PAX3. |
PAX3 Antibody |
1-CSB-PA017489GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PAX3 Antibody |
1-CSB-PA017489HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500 |
Polyclonal Goat Anti-PAX3 Antibody |
APR16352G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-PAX3 . This antibody is tested and proven to work in the following applications: |
Polyclonal PAX3 Antibody (internal region) |
APG00797G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PAX3 (internal region). This antibody is tested and proven to work in the following applications: |
PAX3 Polyclonal Antibody, HRP Conjugated |
A50405 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PAX3 Polyclonal Antibody, FITC Conjugated |
A50406 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PAX3 Polyclonal Antibody, Biotin Conjugated |
A50407 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
PAX3 |
P41025 |
Neuromics |
100 ug Blocking Peptide |
EUR 239 |
Polyclonal PAX3 antibody - N-terminal region |
APR00611G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAX3 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal PAX3 antibody - C-terminal region |
APR00619G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAX3 - C-terminal region. This antibody is tested and proven to work in the following applications: |
PAX3 Conjugated Antibody |
C32380 |
SAB |
100ul |
EUR 397 |
Anti-PAX3 Antibody |
A1657-100 |
Biovision |
|
EUR 370 |
anti- PAX3 antibody |
FNab06169 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:1000
- Immunogen: paired box 3
- Uniprot ID: P23760
- Gene ID: 5077
- Research Area: Neuroscience, Stem Cells, Metabolism, Developmental biology
|
Description: Antibody raised against PAX3 |
anti- PAX3 antibody |
FNab06170 |
FN Test |
100µg |
EUR 585 |
- Immunogen: paired box 3
- Uniprot ID: P23760
- Gene ID: 5077
- Research Area: Neuroscience, Stem Cells, Metabolism, Developmental biology
|
Description: Antibody raised against PAX3 |
Anti-PAX3 antibody |
STJ24909 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. |
Anti-PAX3 antibody |
STJ115865 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. |
Anti-PAX3 antibody |
STJ192417 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PAX3 |
PAX3 siRNA |
20-abx927803 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAX3 siRNA |
20-abx927804 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PAX3 |
YF-PA13616 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PAX3 |
anti-PAX3 |
YF-PA13617 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PAX3 |
anti-PAX3 |
YF-PA24304 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PAX3 |
PAX3 Antibody, HRP conjugated |
1-CSB-PA017489HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PAX3 Antibody, FITC conjugated |
1-CSB-PA017489HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PAX3 Antibody, Biotin conjugated |
1-CSB-PA017489HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PAX3 Blocking Peptide |
DF6548-BP |
Affbiotech |
1mg |
EUR 195 |
PAX3 cloning plasmid |
CSB-CL017489HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 621
- Sequence: atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagat
- Show more
|
Description: A cloning plasmid for the PAX3 gene. |
PAX3 cloning plasmid |
CSB-CL017489HU2-10ug |
Cusabio |
10ug |
EUR 517 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1455
- Sequence: ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTACCCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGCGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGA
- Show more
|
Description: A cloning plasmid for the PAX3 gene. |
Anti-PAX3 (4F4) |
YF-MA14594 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PAX3 |
Anti-PAX3 (3A8) |
YF-MA14595 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PAX3 |
Paired Box 3 (PAX3) Antibody |
abx015952-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Paired Box 3 (PAX3) Antibody |
abx015953-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Paired Box 3 (PAX3) Antibody |
20-abx114310 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Paired Box 3 (PAX3) Antibody |
abx236169-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Paired Box 3 (PAX3) Antibody |
abx236170-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Paired Box 3 (PAX3) Antibody |
abx431489-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Paired Box 3 (PAX3) Antibody |
abx431490-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Monoclonal PAX3 Antibody, Clone: 7D8G7 |
AMM03117G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PAX3. The antibodies are raised in Mouse and are from clone 7D8G7. This antibody is applicable in WB, E |
Monoclonal PAX3 Antibody, Clone: 7D8G7 |
AMM03118G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PAX3. The antibodies are raised in Mouse and are from clone 7D8G7. This antibody is applicable in WB, E |
Anti-Pax3 Antibody (Monoclonal, C2) |
M00285 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Mouse Monoclonal Pax3 Antibody (Monoclonal, C2). Validated in IHC, WB and tested in Human. |
Paired Box 3 (PAX3) Antibody (Biotin) |
abx431491-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Mouse PAX3 shRNA Plasmid |
20-abx971929 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PAX3 shRNA Plasmid |
20-abx953375 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Pax3 Recombinant Protein (Human) |
RP022621 |
ABM |
100 ug |
Ask for price |
Pax3 Recombinant Protein (Human) |
RP042043 |
ABM |
100 ug |
Ask for price |
Pax3 Recombinant Protein (Mouse) |
RP160262 |
ABM |
100 ug |
Ask for price |
Pax3 Recombinant Protein (Mouse) |
RP160265 |
ABM |
100 ug |
Ask for price |
Pax3 Recombinant Protein (Rat) |
RP219383 |
ABM |
100 ug |
Ask for price |
Paired Box Protein Pax-3 (PAX3) Antibody |
20-abx142126 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody |
abx031811-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody |
abx031811-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody |
20-abx302629 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody |
20-abx001407 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Pax3 ORF Vector (Rat) (pORF) |
ORF073129 |
ABM |
1.0 ug DNA |
EUR 506 |
h PAX3 inducible lentiviral particles |
LVP491 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made optional inducible lentiviral particles for expressing human target: h PAX3 (alternative name: CDHS, HUP2, WS1, WS3). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_013942.4. Particles also contains a RFP-Blasticidin dual selection marker. |
PAX3 ORF Vector (Human) (pORF) |
ORF014015 |
ABM |
1.0 ug DNA |
EUR 354 |
PAX3 ORF Vector (Human) (pORF) |
ORF007541 |
ABM |
1.0 ug DNA |
EUR 95 |
Pax3 ORF Vector (Mouse) (pORF) |
ORF053422 |
ABM |
1.0 ug DNA |
EUR 506 |
Pax3 ORF Vector (Mouse) (pORF) |
ORF053423 |
ABM |
1.0 ug DNA |
EUR 506 |
Paired Box Protein Pax-3 (PAX3) Antibody (HRP) |
20-abx304745 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody (FITC) |
20-abx304746 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody (Biotin) |
20-abx304747 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pax3 sgRNA CRISPR Lentivector set (Rat) |
K6937701 |
ABM |
3 x 1.0 ug |
EUR 339 |
PAX3 sgRNA CRISPR Lentivector set (Human) |
K1598501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pax3 sgRNA CRISPR Lentivector set (Mouse) |
K4702801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Monoclonal PAX3 Antibody (C-Terminus, clone C2), Clone: C2 |
AMM01846G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human PAX3 (C-Terminus, clone C2). The antibodies are raised in Mouse and are from clone C2. This antibody is applicable in WB and IHC-P |
Pax3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6937702 |
ABM |
1.0 ug DNA |
EUR 154 |
Pax3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6937703 |
ABM |
1.0 ug DNA |
EUR 154 |
Pax3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6937704 |
ABM |
1.0 ug DNA |
EUR 154 |
PAX3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1598502 |
ABM |
1.0 ug DNA |
EUR 154 |
PAX3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1598503 |
ABM |
1.0 ug DNA |
EUR 154 |
PAX3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1598504 |
ABM |
1.0 ug DNA |
EUR 154 |
Pax3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4702802 |
ABM |
1.0 ug DNA |
EUR 154 |
Pax3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4702803 |
ABM |
1.0 ug DNA |
EUR 154 |
Pax3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4702804 |
ABM |
1.0 ug DNA |
EUR 154 |
Pax3 Protein Vector (Rat) (pPB-C-His) |
PV292514 |
ABM |
500 ng |
EUR 603 |
Pax3 Protein Vector (Rat) (pPB-N-His) |
PV292515 |
ABM |
500 ng |
EUR 603 |
Pax3 Protein Vector (Rat) (pPM-C-HA) |
PV292516 |
ABM |
500 ng |
EUR 603 |
Pax3 Protein Vector (Rat) (pPM-C-His) |
PV292517 |
ABM |
500 ng |
EUR 603 |
Pax3 Protein Vector (Mouse) (pPB-C-His) |
PV213686 |
ABM |
500 ng |
EUR 603 |
PAX3 Rabbit Polyclonal Antibody