PRDX6 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PRDX6 Polyclonal Antibody
ES11152-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PRDX6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
DLR-PRDX6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
DLR-PRDX6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
DLR-PRDX6-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
DLR-PRDX6-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
RDR-PRDX6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
RDR-PRDX6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
RDR-PRDX6-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
RDR-PRDX6-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
RD-PRDX6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
RD-PRDX6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
RD-PRDX6-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
RD-PRDX6-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

PRDX6 Rabbit mAb
A4286-100ul	Abclonal	100 ul	EUR 410

PRDX6 Rabbit mAb
A4286-200ul	Abclonal	200 ul	EUR 571

PRDX6 Rabbit mAb
A4286-20ul	Abclonal	20 ul	EUR 221

PRDX6 Rabbit mAb
A4286-50ul	Abclonal	50 ul	EUR 287

PRDX6 Rabbit pAb
A2031-100ul	Abclonal	100 ul	EUR 308

PRDX6 Rabbit pAb
A2031-200ul	Abclonal	200 ul	EUR 459

PRDX6 Rabbit pAb
A2031-20ul	Abclonal	20 ul	EUR 183

PRDX6 Rabbit pAb
A2031-50ul	Abclonal	50 ul	EUR 223

Polyclonal PRDX6 Antibody (Center)
AMR09505G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal PRDX6 / Peroxiredoxin 6 Antibody
AMR09520G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 / Peroxiredoxin 6 . This antibody is tested and proven to work in the following applications:

Polyclonal PRDX6 / Peroxiredoxin 6 Antibody
AMR09522G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 / Peroxiredoxin 6 . This antibody is tested and proven to work in the following applications:

Polyclonal PRDX6 Antibody (C-term)
AMR09524G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 (C-term). This antibody is tested and proven to work in the following applications:

PRDX6 Antibody
31117-100ul	SAB	100ul	EUR 252

PRDX6 Antibody
31117-50ul	SAB	50ul	EUR 187

PRDX6 antibody
70R-19505	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PRDX6 antibody

PRDX6 antibody
70R-1201	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal PRDX6 antibody raised against the middle region of PRDX6

PRDX6 antibody
70R-2954	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PRDX6 antibody raised against the C terminal of PRDX6

PRDX6 Antibody
32561-100ul	SAB	100ul	EUR 252

PRDX6 Antibody
49475-100ul	SAB	100ul	EUR 333

PRDX6 Antibody
49475-50ul	SAB	50ul	EUR 239

PRDX6 Antibody
1-CSB-PA596780	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PRDX6 Antibody
1-CSB-PA968257	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PRDX6 Antibody
DF6765	Affbiotech	200ul	EUR 304
Description: PRDX6 Antibody detects endogenous levels of total PRDX6.

PRDX6 Antibody
1-CSB-PA018659GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PRDX6 Antibody
1-CSB-PA018659LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

PRDX6 Antibody
ABD6765	Lifescience Market	100 ug	EUR 438

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat)
4-PAF756Ra02	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6)

PRDX6 Conjugated Antibody
C49475	SAB	100ul	EUR 397

PRDX6 Conjugated Antibody
C32561	SAB	100ul	EUR 397

PRDX6 Conjugated Antibody
C31117	SAB	100ul	EUR 397

anti- PRDX6 antibody
FNab06759	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: peroxiredoxin 6 Uniprot ID: P30041 Gene ID: 9588 Research Area: Cancer, Metabolism
Description: Antibody raised against PRDX6

Anti-PRDX6 antibody
PAab06759	Lifescience Market	100 ug	EUR 355

Anti-PRDX6 antibody
STJ25108	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury.

Anti-PRDX6 antibody
STJ192310	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PRDX6

Anti-PRDX6/Peroxiredoxin 6 Rabbit Monoclonal Antibody
M01847	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal PRDX6/Peroxiredoxin 6 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

PRDX6/ Rat PRDX6 ELISA Kit
ELA-E1751r	Lifescience Market	96 Tests	EUR 886

Prdx6/ Rat Prdx6 ELISA Kit
ELI-05680r	Lifescience Market	96 Tests	EUR 886

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine)
4-PAF756Bo01	Cloud-Clone	EUR 276.00 EUR 2972.00 EUR 730.00 EUR 352.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~pro224) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6)

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat)
4-PAF756Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6)

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), APC
4-PAF756Ra02-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), Biotinylated
4-PAF756Ra02-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), Cy3
4-PAF756Ra02-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), FITC
4-PAF756Ra02-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), HRP
4-PAF756Ra02-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), PE
4-PAF756Ra02-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE.

Rabbit Anti-PRDX6 monoclonal antibody, clone KN22-24
DCABH-2690	Creative Diagnostics	100 ul	EUR 777

PRDX6 siRNA
20-abx904221	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PRDX6 siRNA
20-abx929690	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PRDX6 siRNA
20-abx929691	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
abx018042-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
abx018043-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
abx018331-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx214752	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx214753	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx177966	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx177967	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx101561	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx101562	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx104862	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx114402	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx130225	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx142170	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx174004	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Peroxiredoxin 6 (PRDX6) Antibody
abx031800-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
abx031800-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
abx031801-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody
abx031801-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

PRDX6 Antibody, HRP conjugated
1-CSB-PA018659LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRDX6 Antibody, FITC conjugated
1-CSB-PA018659LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRDX6 Antibody, Biotin conjugated
1-CSB-PA018659LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Peroxiredoxin 6 (PRDX6) Antibody
abx236759-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Peroxiredoxin 6 (PRDX6) Antibody
20-abx338412	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

peroxiredoxin 6 (PRDX6) Antibody
abx433117-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

peroxiredoxin 6 (PRDX6) Antibody
abx433118-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

PRDX6 recombinant monoclonal antibody
A5292	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human PRDX6 for WB, IHC,ELISA

Peroxiredoxin 6 (PRDX6) Antibody
20-abx001648	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), APC
4-PAF756Bo01-APC	Cloud-Clone	EUR 389.00 EUR 3905.00 EUR 1070.00 EUR 503.00 EUR 238.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~pro224) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), Biotinylated
4-PAF756Bo01-Biotin	Cloud-Clone	EUR 344.00 EUR 2922.00 EUR 843.00 EUR 427.00 EUR 233.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~pro224) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), Cy3
4-PAF756Bo01-Cy3	Cloud-Clone	EUR 477.00 EUR 5165.00 EUR 1385.00 EUR 629.00 EUR 276.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~pro224) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), FITC
4-PAF756Bo01-FITC	Cloud-Clone	EUR 331.00 EUR 3144.00 EUR 876.00 EUR 422.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~pro224) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), HRP
4-PAF756Bo01-HRP	Cloud-Clone	EUR 354.00 EUR 3401.00 EUR 944.00 EUR 452.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~pro224) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), PE
4-PAF756Bo01-PE	Cloud-Clone	EUR 331.00 EUR 3144.00 EUR 876.00 EUR 422.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~pro224) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat)
4-PAF756Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6)

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), APC
4-PAF756Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAF756Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), Cy3
4-PAF756Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), FITC
4-PAF756Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), HRP
4-PAF756Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), PE
4-PAF756Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), APC-Cy7
4-PAF756Ra02-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7.

Human Peroxiredoxin-6 (PRDX6) Antibody
32833-05111	AssayPro	150 ug	EUR 261

Monoclonal PRDX6 / Peroxiredoxin 6 Antibody
AMR09521G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human PRDX6 / Peroxiredoxin 6. The antibodies are raised in Mouse. This antibody is applicable in IHC-P, E, IP

Peroxiredoxin 6 (PRDX6) Antibody (Biotin)
20-abx272387	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Peroxiredoxin 6 (PRDX6) Antibody (HRP)
20-abx336973	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody (FITC)
20-abx336974	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody (Biotin)
20-abx336975	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody (Biotin)
20-abx273421	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Peroxiredoxin 6 (PRDX6) Antibody (FITC)
20-abx273575	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Anti-Peroxiredoxin 6/PRDX6 Antibody
PB9350	BosterBio	100ug/vial	EUR 334

PRDX6 Blocking Peptide
33R-1499	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRDX6 antibody, catalog no. 70R-1201

PRDX6 Blocking Peptide
33R-9440	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRDX6 antibody, catalog no. 70R-2954

PRDX6 Blocking Peptide
DF6765-BP	Affbiotech	1mg	EUR 195

PRDX6 cloning plasmid
CSB-CL018659HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 675 Sequence: atgcccggaggtctgcttctcggggacgtggctcccaactttgaggccaataccaccgtcggccgcatccgtttccacgactttctgggagactcatggggcattctcttctcccaccctcgggactttaccccagtgtgcaccacagagcttggcagagctgcaaagctggcacc Show more
Description: A cloning plasmid for the PRDX6 gene.

pET28a-PRDX6 Plasmid
PVTB00160-1a	Lifescience Market	2 ug	EUR 356

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), APC-Cy7
4-PAF756Bo01-APC-Cy7	Cloud-Clone	EUR 659.00 EUR 7690.00 EUR 2020.00 EUR 886.00 EUR 356.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~pro224) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAF756Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAF756Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAF756Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAF756Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAF756Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAF756Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAF756Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAF756Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRDX6 (Met1~Pro224) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7.

Human PRDX6 ELISA Kit
ELA-E1751h	Lifescience Market	96 Tests	EUR 824

Human PRDX6 ELISA Kit
EHP0762	Abclonal	96Tests	EUR 521

PRDX6 ELISA KIT|Human
EF006024	Lifescience Market	96 Tests	EUR 689

Rat PRDX6 shRNA Plasmid
20-abx987074	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PRDX6 shRNA Plasmid
20-abx956382	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PRDX6 shRNA Plasmid
20-abx969155	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Peroxiredoxin 6 (PRDX6)
4-RPF756Bo01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O77834 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.9kDa Isoelectric Point: 6.8
Description: Recombinant Bovine Peroxiredoxin 6 expressed in: E.coli

Recombinant Peroxiredoxin 6 (PRDX6)
4-RPF756Hu01	Cloud-Clone	EUR 350.88 EUR 197.00 EUR 1040.80 EUR 413.60 EUR 727.20 EUR 298.00 EUR 2452.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P30041 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Peroxiredoxin 6 expressed in: E.coli

Recombinant Peroxiredoxin 6 (PRDX6)
4-RPF756Mu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O08709 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.6kDa Isoelectric Point: 6.6
Description: Recombinant Mouse Peroxiredoxin 6 expressed in: E.coli

Recombinant Peroxiredoxin 6 (PRDX6)
4-RPF756Ra01	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35244 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.1kDa Isoelectric Point: 6.1
Description: Recombinant Rat Peroxiredoxin 6 expressed in: E.coli

Recombinant Peroxiredoxin 6 (PRDX6)
4-RPF756Ra02	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35244 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.9kDa Isoelectric Point: Inquire
Description: Recombinant Rat Peroxiredoxin 6 expressed in: E.coli

pET28a-TAT-PRDX6 Plasmid
PVTB00160-1b	Lifescience Market	2 ug	EUR 356

pEGFP-N1-PRDX6 Plasmid
PVTB00160-2a	Lifescience Market	2 ug	EUR 356

PRDX6 Recombinant Protein (Human)
RP024538	ABM	100 ug	Ask for price

PRDX6 Recombinant Protein (Mouse)
RP164291	ABM	100 ug	Ask for price

PRDX6 Recombinant Protein (Rat)
RP221966	ABM	100 ug	Ask for price

Human Peroxiredoxin-6 (PRDX6) Antibody (Biotin Conjugate)
32833-05121	AssayPro	150 ug	EUR 369

Cow Peroxiredoxin 6 (PRDX6) Protein
20-abx166297	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Peroxiredoxin 6 (PRDX6) Protein
20-abx068489	Abbexa	EUR 495.00 EUR 244.00 EUR 1414.00 EUR 578.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Rat Peroxiredoxin 6 (PRDX6) Protein
20-abx068490	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Peroxiredoxin 6 (PRDX6) Protein
20-abx068491	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Peroxiredoxin 6 (PRDX6) Protein
20-abx652232	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prdx6 ORF Vector (Rat) (pORF)
ORF073990	ABM	1.0 ug DNA	EUR 506

PRDX6 ORF Vector (Human) (pORF)
ORF008180	ABM	1.0 ug DNA	EUR 95

Prdx6 ORF Vector (Mouse) (pORF)
ORF054765	ABM	1.0 ug DNA	EUR 506

pET28a-(Arg)9-PRDX6 Plasmid
PVTB00160-1c	Lifescience Market	2 ug	EUR 356

PRDX6 ELISA Kit (Human) (OKAN05463)
OKAN05463	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL

PRDX6 ELISA Kit (Mouse) (OKCD02821)
OKCD02821	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29 pg/mL

PRDX6 ELISA Kit (Human) (OKCD08831)
OKCD08831	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: PRDX6 is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL

PRDX6 ELISA Kit (Rat) (OKEH06109)
OKEH06109	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.27 pg/mL

PRDX6 ELISA Kit (Mouse) (OKEH07122)
OKEH07122	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.25 pg/mL

Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (FITC Conjugate)
32833-05141	AssayPro	150 ug	EUR 428

Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (RPE Conjugate)
32833-05151	AssayPro	150 ug	EUR 428

Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (APC Conjugate)
32833-05161	AssayPro	150 ug	EUR 428

Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (PerCP Conjugate)
32833-05171	AssayPro	150 ug	EUR 471

Human Peroxiredoxin 6 (PRDX6)ELISA Kit
201-12-2930	SunredBio	96 tests	EUR 440
This Peroxiredoxin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Peroxiredoxin-6(PRDX6) ELISA kit
CSB-EL018659HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Peroxiredoxin-6 (PRDX6) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Peroxiredoxin-6(PRDX6) ELISA kit
1-CSB-EL018659HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Peroxiredoxin-6(PRDX6) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
20-abx154535	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
20-abx152715	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Prdx6/ Peroxiredoxin-6 ELISA Kit
E0794Ra	Sunlong	1 Kit	EUR 571

Human PRDX6/ Peroxiredoxin-6 ELISA Kit
E2027Hu	Sunlong	1 Kit	EUR 571

Human PRDX6(Peroxiredoxin-6) ELISA Kit
EH1911	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: P30041 Alias: PRDX6/aiPLA2/AOP2/NSGPx/1-Cys/24 kDa protein/Acidic calcium-independent phospholipase A2/aiPLA21-Cys PRX/Antioxidant protein 2/Non-selenium glutathione peroxidase/Red blood cells page spot 12 Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Mouse Peroxiredoxin- 6, Prdx6 ELISA KIT
ELI-05678m	Lifescience Market	96 Tests	EUR 865

Human Peroxiredoxin- 6, PRDX6 ELISA KIT
ELI-05679h	Lifescience Market	96 Tests	EUR 824

Bovine Peroxiredoxin- 6, PRDX6 ELISA KIT
ELI-05681b	Lifescience Market	96 Tests	EUR 928

Chicken Peroxiredoxin- 6, PRDX6 ELISA KIT
ELI-05682c	Lifescience Market	96 Tests	EUR 928

Porcine Peroxiredoxin- 6, PRDX6 ELISA KIT
ELI-05683p	Lifescience Market	96 Tests	EUR 928

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
abx571527-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
abx572818-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Cow Peroxiredoxin 6 (PRDX6) ELISA Kit
abx518341-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Chicken Peroxiredoxin 6 (PRDX6) ELISA Kit
abx518342-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
abx518343-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Pig Peroxiredoxin 6 (PRDX6) ELISA Kit
abx518345-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Peroxiredoxin 6 (PRDX6) ELISA Kit
abx518346-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Peroxiredoxin 6 (PRDX6) CLIA Kit
20-abx494996	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Peroxiredoxin 6 (PRDX6) CLIA Kit
20-abx494997	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Prdx6 sgRNA CRISPR Lentivector set (Rat)
K7039501	ABM	3 x 1.0 ug	EUR 339

Prdx6 sgRNA CRISPR Lentivector set (Mouse)
K4354001	ABM	3 x 1.0 ug	EUR 339

PRDX6 sgRNA CRISPR Lentivector set (Human)
K2823601	ABM	3 x 1.0 ug	EUR 339

PRDX6 Peroxiredoxin-6 Human Recombinant Protein
PROTP30041	BosterBio	Regular: 20ug	EUR 317
Description: Peroxiredoxin- 6 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27.1kDa.;The Peroxiredoxin-6 is purified by proprietary chromatographic techniques.

Human Peroxiredoxin 6(PRDX6)ELISA Kit
QY-E03244	Qayee Biotechnology	96T	EUR 361

Human Peroxiredoxin 6 ELISA Kit (PRDX6)
RK02130	Abclonal	96 Tests	EUR 521

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
SEF756Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
SEF756Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
SEF756Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
SEF756Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit
4-SEF756Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Peroxiredoxin 6 elisa. Alternative names of the recognized antigen: 1-Cys AOP2 NSGPx PRX aiPLA2 p29 Acidic calcium-independent phospholipase A2 Antioxidant protein 2 Non-selenium glutathione peroxidase Red blood cells page spot Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
SEF756Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
SEF756Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
SEF756Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
SEF756Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit
4-SEF756Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Peroxiredoxin 6 elisa. Alternative names of the recognized antigen: 1-Cys AOP2 NSGPx PRX aiPLA2 p29 Acidic calcium-independent phospholipase A2 Antioxidant protein 2 Non-selenium glutathione peroxidase Red blood cells page spot Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Monoclonal PRDX6 / Peroxiredoxin 6 Antibody (clone 4A3), Clone: 4A3
AMR09523G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human PRDX6 / Peroxiredoxin 6 (clone 4A3). The antibodies are raised in Mouse and are from clone 4A3. This antibody is applicable in WB and IHC-P, E

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

PRDX6 Rabbit Polyclonal Antibody