KLK5 Rabbit Polyclonal Antibody
KLK5 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
KLK5 Polyclonal Antibody |
ES11097-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against KLK5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
KLK5 Polyclonal Antibody |
ABP59064-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein |
KLK5 Polyclonal Antibody |
ABP59064-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein |
KLK5 Polyclonal Antibody |
ABP59064-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein |
KLK5 Polyclonal Antibody |
A51429 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Human Kallikrein 5 (KLK5) ELISA Kit |
DLR-KLK5-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids. |
Human Kallikrein 5 (KLK5) ELISA Kit |
DLR-KLK5-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
DLR-KLK5-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
DLR-KLK5-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Kallikrein 5 (KLK5) ELISA Kit |
RD-KLK5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Kallikrein 5 (KLK5) ELISA Kit |
RD-KLK5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
RD-KLK5-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
RD-KLK5-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Human Kallikrein 5 (KLK5) ELISA Kit |
RDR-KLK5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Kallikrein 5 (KLK5) ELISA Kit |
RDR-KLK5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
RDR-KLK5-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
RDR-KLK5-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
KLK5 Rabbit pAb |
A10917-100ul |
Abclonal |
100 ul |
EUR 308 |
KLK5 Rabbit pAb |
A10917-200ul |
Abclonal |
200 ul |
EUR 459 |
KLK5 Rabbit pAb |
A10917-20ul |
Abclonal |
20 ul |
Ask for price |
KLK5 Rabbit pAb |
A10917-50ul |
Abclonal |
50 ul |
Ask for price |
KLK5 Rabbit pAb |
A2991-100ul |
Abclonal |
100 ul |
EUR 308 |
KLK5 Rabbit pAb |
A2991-200ul |
Abclonal |
200 ul |
EUR 459 |
KLK5 Rabbit pAb |
A2991-20ul |
Abclonal |
20 ul |
EUR 183 |
KLK5 Rabbit pAb |
A2991-50ul |
Abclonal |
50 ul |
EUR 223 |
KLK5 Rabbit pAb |
A14863-100ul |
Abclonal |
100 ul |
EUR 308 |
KLK5 Rabbit pAb |
A14863-200ul |
Abclonal |
200 ul |
EUR 459 |
KLK5 Rabbit pAb |
A14863-20ul |
Abclonal |
20 ul |
EUR 183 |
KLK5 Rabbit pAb |
A14863-50ul |
Abclonal |
50 ul |
EUR 223 |
KLK5 antibody |
70R-6355 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal KLK5 antibody raised against the N terminal of KLK5 |
KLK5 Antibody |
36941-100ul |
SAB |
100ul |
EUR 252 |
KLK5 antibody |
38528-100ul |
SAB |
100ul |
EUR 252 |
KLK5 antibody |
70R-18162 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal KLK5 antibody |
KLK5 antibody |
70R-14167 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal KLK5 antibody |
KLK5 Antibody |
DF7137 |
Affbiotech |
200ul |
EUR 304 |
Description: KLK5 Antibody detects endogenous levels of total KLK5. |
KLK5 Antibody |
1-CSB-PA897100LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
KLK5 Antibody |
1-CSB-PA012456GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
KLK5 Antibody |
1-CSB-PA175566 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300 |
Polyclonal Goat Anti-KLK5 Antibody |
APG00182G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KLK5 . This antibody is tested and proven to work in the following applications: |
Kallikrein 5 (KLK5) polyclonal antibody |
ABP-PAB-10238 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
KLK5 Polyclonal Antibody, HRP Conjugated |
A51430 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
KLK5 Polyclonal Antibody, FITC Conjugated |
A51431 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
KLK5 Polyclonal Antibody, Biotin Conjugated |
A51432 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse) |
4-PAA451Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK5 (Ile25~Ala261)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5) |
KLK5 Conjugated Antibody |
C36941 |
SAB |
100ul |
EUR 397 |
KLK5 Conjugated Antibody |
C38528 |
SAB |
100ul |
EUR 397 |
Anti-KLK5 antibody |
STJ24335 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein. |
Anti-KLK5 antibody |
STJ112813 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein. |
Anti-KLK5 antibody |
STJ117063 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein. |
Anti-KLK5 antibody |
STJ192255 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to KLK5 |
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), APC |
4-PAA451Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK5 (Ile25~Ala261)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with APC. |
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA451Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK5 (Ile25~Ala261)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with Biotin. |
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), Cy3 |
4-PAA451Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK5 (Ile25~Ala261)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with Cy3. |
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), FITC |
4-PAA451Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK5 (Ile25~Ala261)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with FITC. |
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), HRP |
4-PAA451Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK5 (Ile25~Ala261)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with HRP. |
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), PE |
4-PAA451Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK5 (Ile25~Ala261)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with PE. |
KLK5 siRNA |
20-abx921842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody |
20-abx126956 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody |
20-abx113307 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody |
20-abx002175 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody |
abx145910-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody |
20-abx100977 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kallikrein 5 (KLK5) Antibody |
abx032799-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody |
abx032799-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody |
20-abx173230 |
Abbexa |
|
|
|
Kallikrein 5 (KLK5) Antibody |
20-abx177251 |
Abbexa |
|
|
|
Kallikrein 5 (KLK5) Antibody |
20-abx177252 |
Abbexa |
|
|
|
Kallikrein 5 (KLK5) Antibody |
abx432899-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Kallikrein 5 (KLK5) Antibody |
abx234459-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Kallikrein 5 (KLK5) Antibody |
20-abx302883 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody |
20-abx212478 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KLK5 Antibody, HRP conjugated |
1-CSB-PA897100LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
KLK5 Antibody, FITC conjugated |
1-CSB-PA897100LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
KLK5 Antibody, Biotin conjugated |
1-CSB-PA897100LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAA451Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK5 (Ile25~Ala261)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with APC-Cy7. |
KLK5 Blocking Peptide |
33R-1662 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK5 antibody, catalog no. 70R-6355 |
KLK5 Blocking Peptide |
DF7137-BP |
Affbiotech |
1mg |
EUR 195 |
KLK5 cloning plasmid |
CSB-CL897100HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 882
- Sequence: atggctacagcaagacccccctggatgtgggtgctctgtgctctgatcacagccttgcttctgggggtcacagagcatgttctcgccaacaatgatgtttcctgtgaccacccctctaacaccgtgccctctgggagcaaccaggacctgggagctggggccggggaagacgcccg
- Show more
|
Description: A cloning plasmid for the KLK5 gene. |
Kallikrein 5 (KLK5) Antibody (HRP) |
20-abx312475 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody (FITC) |
20-abx312476 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kallikrein 5 (KLK5) Antibody (Biotin) |
20-abx312477 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Kallikrein 5/KLK5 Antibody |
PA1630 |
BosterBio |
100ug/vial |
EUR 334 |
Human KLK5 shRNA Plasmid |
20-abx958517 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KLK5 protein (His tag) |
80R-2369 |
Fitzgerald |
20 ug |
EUR 349 |
Description: Purified recombinant Human KLK5 protein (His tag) |
Human KLK5 ELISA Kit |
55R-1762 |
Fitzgerald |
1 kit |
EUR 651 |
Description: ELISA Kit for detection of KLK5 in the research laboratory |
Kallikrein 5/KLK5/KLKL2 |
MO15028 |
Neuromics |
500 ug |
EUR 513 |
Human KLK5 ELISA Kit |
LF-EK50922 |
Abfrontier |
1×96T |
EUR 648 |
Recombinant Kallikrein 5 (KLK5) |
4-RPA451Mu01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P15945
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.0kDa
- Isoelectric Point: 6
|
Description: Recombinant Mouse Kallikrein 5 expressed in: E.coli |
KLK5 Recombinant Protein (Human) |
RP017254 |
ABM |
100 ug |
Ask for price |
Kallikrein 5/KLK5/KLKL2 |
RA19046 |
Neuromics |
100 ug |
EUR 344 |
KLK5 Recombinant Protein (Mouse) |
RP146141 |
ABM |
100 ug |
Ask for price |
Human Kallikrein 5 (KLK5) Protein |
20-abx654098 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human KLK5 PicoKine ELISA Kit |
EK0817 |
BosterBio |
96 wells |
EUR 456 |
Description: For quantitative detection of human KLK5 in cell culture supernates, serum, plasma(heparin , EDTA), human milk and saliva. |
Mouse Kallikrein 5 (KLK5) Protein |
20-abx067589 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
KLK5 ORF Vector (Human) (pORF) |
ORF005752 |
ABM |
1.0 ug DNA |
EUR 95 |
Klk5 ORF Vector (Mouse) (pORF) |
ORF048715 |
ABM |
1.0 ug DNA |
EUR 506 |
KLK5 ELISA Kit (Human) (OKBB00333) |
OKBB00333 |
Aviva Systems Biology |
96 Tests |
EUR 544 |
Description: Description of target: Kallikrein gene 5 (KLK5, also known as KLK-L2), located on chromosome 19q13.4, is one of the newly identified members of the kallikrein gene family, which is a subgroup of the serine protease enzyme family. In normal human tissues, KLK5 is highly expressed in skin, mammary gland and testis. KLK5 has been suggested to regulate cell shedding (desquamation) in conjunction with KLK7 and KLK14, given its ability to degrade proteins which form the extracellular component of cell junctions in the stratum corneum. It is proposed that KLK5 regulates this process since it is able to self-activate in addition to activating KLK7 and KLK14.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 10 pg/ml |
KLK5 ELISA Kit (Human) (OKCD06351) |
OKCD06351 |
Aviva Systems Biology |
96 Wells |
EUR 609 |
Description: Description of target: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 12.5pg/mL |
Human Kallikrein 5 (KLK5) ELISA Kit |
abx576328-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human KLK5/ Kallikrein-5 ELISA Kit |
E1390Hu |
Sunlong |
1 Kit |
EUR 537 |
Human KLK5(Kallikrein-5) ELISA Kit |
EH0213 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9Y337
- Alias: KLK5/Kallikrein-like protein 2(KLK-L2)/Stratum corneum tryptic enzyme
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
20-abx154283 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Kallikrein 5 (KLK5) ELISA Kit |
20-abx152090 |
Abbexa |
-
EUR 5640.00
-
EUR 3009.00
-
EUR 707.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Kallikrein 5 (KLK5) CLIA Kit |
20-abx491508 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Kallikrein 5 (KLK5) CLIA Kit |
20-abx491509 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Kallikrein 5 (KLK5) ELISA Kit |
abx251464-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
KLK5 sgRNA CRISPR Lentivector set (Human) |
K1159901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Kallikrein-5(KLK5) ELISA kit |
CSB-EL012456HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Kallikrein-5 (KLK5) in samples from serum, plasma, cell culture supernates, tissue homogenates, saliva. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Kallikrein-5(KLK5) ELISA kit |
1-CSB-EL012456HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Kallikrein-5(KLK5) in samples from serum, plasma, cell culture supernates, tissue homogenates, saliva. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Klk5 sgRNA CRISPR Lentivector set (Mouse) |
K3032901 |
ABM |
3 x 1.0 ug |
EUR 339 |
KLK5 Kallikrein-5 Human Recombinant Protein |
PROTQ9Y337 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: KLK5 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 252 amino acids (67-293) and having a molecular mass of 27.8kDa.;KLK5 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Kallikrein 5 (KLK5) ELISA Kit |
SEA451Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 3409.41 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids. |
Human Kallikrein 5 (KLK5) ELISA Kit |
SEA451Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 368.42 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids. |
Human Kallikrein 5 (KLK5) ELISA Kit |
SEA451Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 483.46 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids. |
Human Kallikrein 5 (KLK5) ELISA Kit |
SEA451Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 1875.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids. |
Human Kallikrein 5 (KLK5) ELISA Kit |
4-SEA451Hu |
Cloud-Clone |
-
EUR 3460.00
-
EUR 1826.00
-
EUR 484.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 5 elisa. Alternative names of the recognized antigen: KLK-L2
- KLKL2
- SCTE
- Kallikrein-Related Peptidase 5
- Kallikrein-like protein 2
- Stratum corneum tryptic enzyme
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
SEA451Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
SEA451Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
SEA451Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
SEA451Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
4-SEA451Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 5 elisa. Alternative names of the recognized antigen: KLK-L2
- KLKL2
- SCTE
- Kallikrein-Related Peptidase 5
- Kallikrein-like protein 2
- Stratum corneum tryptic enzyme
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein 5 ELISA Kit (KLK5) |
RK02973 |
Abclonal |
96 Tests |
EUR 521 |
Recombinant Human Kallikrein 5/KLK5 (C-6His) |
C415-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 5/KLK5 (C-6His) |
C415-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 5/KLK5 (C-6His) |
C415-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 5/KLK5 (C-6His) |
C415-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
ELISA kit for Mouse KLK5 (Kallikrein 5) |
ELK2371 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 5 (KLK5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 5 (
- Show more
|
Description: A sandwich ELISA kit for detection of Kallikrein 5 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human KLK5 (Kallikrein 5) |
ELK1203 |
ELK Biotech |
1 plate of 96 wells |
EUR 372 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 5 (KLK5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 5 (
- Show more
|
Description: A sandwich ELISA kit for detection of Kallikrein 5 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
KLK5 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1159902 |
ABM |
1.0 ug DNA |
EUR 154 |
KLK5 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1159903 |
ABM |
1.0 ug DNA |
EUR 154 |
KLK5 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1159904 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3032902 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3032903 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3032904 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Human Kallikrein-5 (KLK5) |
KTE61896-48T |
Abbkine |
48T |
EUR 332 |
- KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kallikrein-5 (KLK5) |
KTE61896-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kallikrein-5 (KLK5) |
KTE61896-96T |
Abbkine |
96T |
EUR 539 |
- KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Recombinant Human KLK5 Protein, His, E.coli-100ug |
QP12507-HIS-100ug |
EnQuireBio |
100ug |
EUR 1261 |
Recombinant Human KLK5 Protein, His, E.coli-1mg |
QP12507-HIS-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human KLK5 Protein, His, E.coli-10ug |
QP12507-HIS-EC-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human KLK5 Protein, His, E.coli-2ug |
QP12507-HIS-EC-2ug |
EnQuireBio |
2ug |
EUR 155 |
Recombinant Human KLK5 Protein, His, Insect-10ug |
QP12507-HIS-INSECT-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human KLK5 Protein, His, Insect-2ug |
QP12507-HIS-INSECT-2ug |
EnQuireBio |
2ug |
EUR 155 |
KLK5 Protein Vector (Human) (pPB-C-His) |
PV023005 |
ABM |
500 ng |
EUR 329 |
KLK5 Protein Vector (Human) (pPB-N-His) |
PV023006 |
ABM |
500 ng |
EUR 329 |
KLK5 Protein Vector (Human) (pPM-C-HA) |
PV023007 |
ABM |
500 ng |
EUR 329 |
KLK5 Protein Vector (Human) (pPM-C-His) |
PV023008 |
ABM |
500 ng |
EUR 329 |
KLK5 Protein Vector (Mouse) (pPB-C-His) |
PV194858 |
ABM |
500 ng |
EUR 603 |
KLK5 Protein Vector (Mouse) (pPB-N-His) |
PV194859 |
ABM |
500 ng |
EUR 603 |
KLK5 Protein Vector (Mouse) (pPM-C-HA) |
PV194860 |
ABM |
500 ng |
EUR 603 |
KLK5 Protein Vector (Mouse) (pPM-C-His) |
PV194861 |
ABM |
500 ng |
EUR 603 |
Klk5 3'UTR Luciferase Stable Cell Line |
TU206799 |
ABM |
1.0 ml |
Ask for price |
Klk5 3'UTR GFP Stable Cell Line |
TU160683 |
ABM |
1.0 ml |
Ask for price |
KLK5 3'UTR Luciferase Stable Cell Line |
TU011891 |
ABM |
1.0 ml |
EUR 1394 |
Klk5 3'UTR Luciferase Stable Cell Line |
TU110683 |
ABM |
1.0 ml |
Ask for price |
KLK5 3'UTR GFP Stable Cell Line |
TU061891 |
ABM |
1.0 ml |
EUR 1394 |
Klk5 3'UTR GFP Stable Cell Line |
TU256799 |
ABM |
1.0 ml |
Ask for price |
KLK5 ELISA Kit (Human) : 96 Wells (OKEH02813) |
OKEH02813 |
Aviva Systems Biology |
96 Wells |
EUR 544 |
Description: Description of target: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
KLK5 Rabbit Polyclonal Antibody