KLK5 Rabbit Polyclonal Antibody

KLK5 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

KLK5 Polyclonal Antibody
ABP59064-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein
KLK5 Polyclonal Antibody
ABP59064-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein
KLK5 Polyclonal Antibody
ABP59064-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein
KLK5 Polyclonal Antibody
ES11097-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KLK5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
KLK5 Polyclonal Antibody
ES11097-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KLK5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Kallikrein 5 (KLK5) ELISA Kit
DLR-KLK5-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.
Human Kallikrein 5 (KLK5) ELISA Kit
DLR-KLK5-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.
Mouse Kallikrein 5 (KLK5) ELISA Kit
DLR-KLK5-Mu-48T 48T
EUR 489
  • Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Kallikrein 5 (KLK5) ELISA Kit
DLR-KLK5-Mu-96T 96T
EUR 635
  • Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Kallikrein 5 (KLK5) ELISA Kit
RDR-KLK5-Hu-48Tests 48 Tests
EUR 500
Human Kallikrein 5 (KLK5) ELISA Kit
RDR-KLK5-Hu-96Tests 96 Tests
EUR 692
Mouse Kallikrein 5 (KLK5) ELISA Kit
RDR-KLK5-Mu-48Tests 48 Tests
EUR 511
Mouse Kallikrein 5 (KLK5) ELISA Kit
RDR-KLK5-Mu-96Tests 96 Tests
EUR 709
Human Kallikrein 5 (KLK5) ELISA Kit
RD-KLK5-Hu-48Tests 48 Tests
EUR 478
Human Kallikrein 5 (KLK5) ELISA Kit
RD-KLK5-Hu-96Tests 96 Tests
EUR 662
Mouse Kallikrein 5 (KLK5) ELISA Kit
RD-KLK5-Mu-48Tests 48 Tests
EUR 489
Mouse Kallikrein 5 (KLK5) ELISA Kit
RD-KLK5-Mu-96Tests 96 Tests
EUR 677
KLK5 Rabbit pAb
A10917-100ul 100 ul
EUR 308
KLK5 Rabbit pAb
A10917-200ul 200 ul
EUR 459
KLK5 Rabbit pAb
A10917-20ul 20 ul Ask for price
KLK5 Rabbit pAb
A10917-50ul 50 ul Ask for price
KLK5 Rabbit pAb
A2991-100ul 100 ul
EUR 308
KLK5 Rabbit pAb
A2991-200ul 200 ul
EUR 459
KLK5 Rabbit pAb
A2991-20ul 20 ul
EUR 183
KLK5 Rabbit pAb
A2991-50ul 50 ul
EUR 223
KLK5 Rabbit pAb
A14863-100ul 100 ul
EUR 308
KLK5 Rabbit pAb
A14863-200ul 200 ul
EUR 459
KLK5 Rabbit pAb
A14863-20ul 20 ul
EUR 183
KLK5 Rabbit pAb
A14863-50ul 50 ul
EUR 223
KLK5 antibody
70R-18162 50 ul
EUR 435
Description: Rabbit polyclonal KLK5 antibody
KLK5 antibody
70R-14167 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal KLK5 antibody
KLK5 Antibody
36941-100ul 100ul
EUR 252
KLK5 antibody
38528-100ul 100ul
EUR 252
KLK5 Antibody
1-CSB-PA897100LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
KLK5 Antibody
DF7137 200ul
EUR 304
Description: KLK5 Antibody detects endogenous levels of total KLK5.
KLK5 Antibody
1-CSB-PA175566
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300
KLK5 antibody
70R-6355 50 ug
EUR 467
Description: Rabbit polyclonal KLK5 antibody raised against the N terminal of KLK5
KLK5 Antibody
1-CSB-PA012456GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
KLK5 Antibody
ABD7137 100 ug
EUR 438
Polyclonal Goat Anti-KLK5 Antibody
APG00182G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KLK5 . This antibody is tested and proven to work in the following applications:
Kallikrein 5 (KLK5) polyclonal antibody
ABP-PAB-10238 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
KLK5 Polyclonal Antibody, HRP Conjugated
A51430 100 µg
EUR 570.55
Description: reagents widely cited
KLK5 Polyclonal Antibody, FITC Conjugated
A51431 100 µg
EUR 570.55
Description: Ask the seller for details
KLK5 Polyclonal Antibody, Biotin Conjugated
A51432 100 µg
EUR 570.55
Description: The best epigenetics products
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse)
4-PAA451Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5)
KLK5 Conjugated Antibody
C36941 100ul
EUR 397
KLK5 Conjugated Antibody
C38528 100ul
EUR 397
Anti-KLK5 antibody
STJ24335 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.
Anti-KLK5 antibody
STJ112813 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.
Anti-KLK5 antibody
STJ117063 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.
Anti-KLK5 antibody
STJ71121 100 µg
EUR 359
Anti-KLK5 antibody
STJ192255 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KLK5
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), APC
4-PAA451Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with APC.
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), Biotinylated
4-PAA451Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with Biotin.
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), Cy3
4-PAA451Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with Cy3.
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), FITC
4-PAA451Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with FITC.
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), HRP
4-PAA451Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with HRP.
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), PE
4-PAA451Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with PE.
KLK5 siRNA
20-abx921842
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KLK5 Antibody, HRP conjugated
1-CSB-PA897100LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
KLK5 Antibody, FITC conjugated
1-CSB-PA897100LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
KLK5 Antibody, Biotin conjugated
1-CSB-PA897100LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Kallikrein 5 (KLK5) Antibody
20-abx177251
  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.
Kallikrein 5 (KLK5) Antibody
20-abx177252
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
Kallikrein 5 (KLK5) Antibody
20-abx212478
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody
20-abx100977
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Kallikrein 5 (KLK5) Antibody
20-abx113307
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody
20-abx126956
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody
abx145910-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody
20-abx173230
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
Kallikrein 5 (KLK5) Antibody
abx032799-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody
abx032799-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody
abx234459-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Kallikrein 5 (KLK5) Antibody
abx432899-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Kallikrein 5 (KLK5) Antibody
20-abx302883
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody
20-abx002175
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA451Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with APC-Cy7.
KLK5 Blocking Peptide
33R-1662 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK5 antibody, catalog no. 70R-6355
KLK5 cloning plasmid
CSB-CL897100HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 882
  • Sequence: atggctacagcaagacccccctggatgtgggtgctctgtgctctgatcacagccttgcttctgggggtcacagagcatgttctcgccaacaatgatgtttcctgtgaccacccctctaacaccgtgccctctgggagcaaccaggacctgggagctggggccggggaagacgcccg
  • Show more
Description: A cloning plasmid for the KLK5 gene.
KLK5 Blocking Peptide
DF7137-BP 1mg
EUR 195
Kallikrein 5 (KLK5) Antibody (HRP)
20-abx312475
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody (FITC)
20-abx312476
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kallikrein 5 (KLK5) Antibody (Biotin)
20-abx312477
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Kallikrein 5/KLK5 Antibody
PA1630 100ug/vial
EUR 334
Human KLK5 ELISA Kit
55R-1762 1 kit
EUR 651
Description: ELISA Kit for detection of KLK5 in the research laboratory
KLK5 protein (His tag)
80R-2369 20 ug
EUR 349
Description: Purified recombinant Human KLK5 protein (His tag)
Human KLK5 ELISA Kit
ELA-E1163h 96 Tests
EUR 824
KLK5 ELISA KIT|Human
EF010935 96 Tests
EUR 689
Human KLK5 shRNA Plasmid
20-abx958517
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human KLK5 ELISA Kit
LF-EK50922 1×96T
EUR 648
Kallikrein 5/KLK5/KLKL2
MO15028 500 ug
EUR 513
Kallikrein 5/KLK5/KLKL2
RA19046 100 ug
EUR 344
Recombinant Kallikrein 5 (KLK5)
4-RPA451Mu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15945
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.0kDa
  • Isoelectric Point: 6
Description: Recombinant Mouse Kallikrein 5 expressed in: E.coli
KLK5 Recombinant Protein (Human)
RP017254 100 ug Ask for price
KLK5 Recombinant Protein (Mouse)
RP146141 100 ug Ask for price
Mouse Kallikrein 5 (KLK5) Protein
20-abx067589
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human KLK5 PicoKine ELISA Kit
EK0817 96 wells
EUR 456
Description: For quantitative detection of human KLK5 in cell culture supernates, serum, plasma(heparin , EDTA), human milk and saliva.
Human Kallikrein 5 (KLK5) Protein
20-abx654098
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
KLK5 ORF Vector (Human) (pORF)
ORF005752 1.0 ug DNA
EUR 95
Klk5 ORF Vector (Mouse) (pORF)
ORF048715 1.0 ug DNA
EUR 506
KLK5 ELISA Kit (Human) (OKBB00333)
OKBB00333 96 Tests
EUR 544
Description: Description of target: Kallikrein gene 5 (KLK5, also known as KLK-L2), located on chromosome 19q13.4, is one of the newly identified members of the kallikrein gene family, which is a subgroup of the serine protease enzyme family. In normal human tissues, KLK5 is highly expressed in skin, mammary gland and testis. KLK5 has been suggested to regulate cell shedding (desquamation) in conjunction with KLK7 and KLK14, given its ability to degrade proteins which form the extracellular component of cell junctions in the stratum corneum. It is proposed that KLK5 regulates this process since it is able to self-activate in addition to activating KLK7 and KLK14.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 10 pg/ml
KLK5 ELISA Kit (Human) (OKCD06351)
OKCD06351 96 Wells
EUR 609
Description: Description of target: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 12.5pg/mL
Mouse Kallikrein 5 (KLK5) ELISA Kit
20-abx154283
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Kallikrein 5 (KLK5) ELISA Kit
20-abx152090
  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Kallikrein 5 (KLK5) ELISA Kit
abx251464-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.
Human KLK5/ Kallikrein-5 ELISA Kit
E1390Hu 1 Kit
EUR 537
Human KLK5(Kallikrein-5) ELISA Kit
EH0213 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9Y337
  • Alias: KLK5/Kallikrein-like protein 2(KLK-L2)/Stratum corneum tryptic enzyme
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Kallikrein- 5, KLK5 ELISA KIT
ELI-03824h 96 Tests
EUR 824
Human Kallikrein-5(KLK5) ELISA kit
CSB-EL012456HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Kallikrein-5 (KLK5) in samples from serum, plasma, cell culture supernates, tissue homogenates, saliva. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Kallikrein-5(KLK5) ELISA kit
1-CSB-EL012456HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Kallikrein-5(KLK5) in samples from serum, plasma, cell culture supernates, tissue homogenates, saliva. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Kallikrein 5 (KLK5) ELISA Kit
abx576328-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Kallikrein 5 (KLK5) CLIA Kit
20-abx491508
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Kallikrein 5 (KLK5) CLIA Kit
20-abx491509
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Klk5 sgRNA CRISPR Lentivector set (Mouse)
K3032901 3 x 1.0 ug
EUR 339
KLK5 sgRNA CRISPR Lentivector set (Human)
K1159901 3 x 1.0 ug
EUR 339
KLK5 Kallikrein-5 Human Recombinant Protein
PROTQ9Y337 Regular: 10ug
EUR 317
Description: KLK5 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 252 amino acids (67-293) and having a molecular mass of 27.8kDa.;KLK5 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Kallikrein 5 (KLK5) ELISA Kit
SEA451Hu-10x96wellstestplate 10x96-wells test plate
EUR 3409.41
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids.
Human Kallikrein 5 (KLK5) ELISA Kit
SEA451Hu-1x48wellstestplate 1x48-wells test plate
EUR 368.42
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids.
Human Kallikrein 5 (KLK5) ELISA Kit
SEA451Hu-1x96wellstestplate 1x96-wells test plate
EUR 483.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids.
Human Kallikrein 5 (KLK5) ELISA Kit
SEA451Hu-5x96wellstestplate 5x96-wells test plate
EUR 1875.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids.
Human Kallikrein 5 (KLK5) ELISA Kit
4-SEA451Hu
  • EUR 3460.00
  • EUR 1826.00
  • EUR 484.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 5 elisa. Alternative names of the recognized antigen: KLK-L2
  • KLKL2
  • SCTE
  • Kallikrein-Related Peptidase 5
  • Kallikrein-like protein 2
  • Stratum corneum tryptic enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Kallikrein 5 (KLK5) ELISA Kit
SEA451Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Kallikrein 5 (KLK5) ELISA Kit
SEA451Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Kallikrein 5 (KLK5) ELISA Kit
SEA451Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Kallikrein 5 (KLK5) ELISA Kit
SEA451Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Kallikrein 5 (KLK5) ELISA Kit
4-SEA451Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 5 elisa. Alternative names of the recognized antigen: KLK-L2
  • KLKL2
  • SCTE
  • Kallikrein-Related Peptidase 5
  • Kallikrein-like protein 2
  • Stratum corneum tryptic enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Kallikrein 5 ELISA Kit (KLK5)
RK02973 96 Tests
EUR 521
Mouse Kallikrein-5(KLK5) ELISA kit
QY-E21646 96T
EUR 361
ELISA kit for Mouse KLK5 (Kallikrein 5)
ELK2371 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 5 (KLK5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 5 (
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 5 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human KLK5 (Kallikrein 5)
ELK1203 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 5 (KLK5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 5 (
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 5 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Recombinant Human Kallikrein 5/KLK5 (C-6His)
C415-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.
Recombinant Human Kallikrein 5/KLK5 (C-6His)
C415-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.
Recombinant Human Kallikrein 5/KLK5 (C-6His)
C415-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.
Recombinant Human Kallikrein 5/KLK5 (C-6His)
C415-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.
Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3032902 1.0 ug DNA
EUR 154
Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3032903 1.0 ug DNA
EUR 154
Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3032904 1.0 ug DNA
EUR 154
KLK5 sgRNA CRISPR Lentivector (Human) (Target 1)
K1159902 1.0 ug DNA
EUR 154
KLK5 sgRNA CRISPR Lentivector (Human) (Target 2)
K1159903 1.0 ug DNA
EUR 154
KLK5 sgRNA CRISPR Lentivector (Human) (Target 3)
K1159904 1.0 ug DNA
EUR 154
ELISA kit for Human Kallikrein-5 (KLK5)
KTE61896-48T 48T
EUR 332
  • KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Kallikrein-5 (KLK5)
KTE61896-5platesof96wells 5 plates of 96 wells
EUR 2115
  • KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Kallikrein-5 (KLK5)
KTE61896-96T 96T
EUR 539
  • KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
KLK5 Protein Vector (Human) (pPB-C-His)
PV023005 500 ng
EUR 329
KLK5 Protein Vector (Human) (pPB-N-His)
PV023006 500 ng
EUR 329
KLK5 Protein Vector (Human) (pPM-C-HA)
PV023007 500 ng
EUR 329
KLK5 Protein Vector (Human) (pPM-C-His)
PV023008 500 ng
EUR 329
KLK5 Protein Vector (Mouse) (pPB-C-His)
PV194858 500 ng
EUR 603
KLK5 Protein Vector (Mouse) (pPB-N-His)
PV194859 500 ng
EUR 603
KLK5 Protein Vector (Mouse) (pPM-C-HA)
PV194860 500 ng
EUR 603
KLK5 Protein Vector (Mouse) (pPM-C-His)
PV194861 500 ng
EUR 603
Recombinant Human KLK5 Protein, His, E.coli-100ug
QP12507-HIS-100ug 100ug
EUR 1261
Recombinant Human KLK5 Protein, His, E.coli-1mg
QP12507-HIS-1mg 1mg
EUR 5251
Recombinant Human KLK5 Protein, His, E.coli-10ug
QP12507-HIS-EC-10ug 10ug
EUR 201
Recombinant Human KLK5 Protein, His, E.coli-2ug
QP12507-HIS-EC-2ug 2ug
EUR 155
Recombinant Human KLK5 Protein, His, Insect-10ug
QP12507-HIS-INSECT-10ug 10ug
EUR 201
Recombinant Human KLK5 Protein, His, Insect-2ug
QP12507-HIS-INSECT-2ug 2ug
EUR 155
Klk5 3'UTR Luciferase Stable Cell Line
TU110683 1.0 ml Ask for price
Klk5 3'UTR GFP Stable Cell Line
TU160683 1.0 ml Ask for price
Klk5 3'UTR Luciferase Stable Cell Line
TU206799 1.0 ml Ask for price
Klk5 3'UTR GFP Stable Cell Line
TU256799 1.0 ml Ask for price
KLK5 3'UTR GFP Stable Cell Line
TU061891 1.0 ml
EUR 1394
KLK5 3'UTR Luciferase Stable Cell Line
TU011891 1.0 ml
EUR 1394
KLK5 ELISA Kit (Human) : 96 Wells (OKEH02813)
OKEH02813 96 Wells
EUR 544
Description: Description of target: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

KLK5 Rabbit Polyclonal Antibody