NR4A2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

NR4A2 Polyclonal Antibody
ES11283-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR4A2 Polyclonal Antibody
ES11283-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR4A2 Rabbit pAb
A17318-100ul	Abclonal	100 ul	EUR 308

NR4A2 Rabbit pAb
A17318-200ul	Abclonal	200 ul	EUR 459

NR4A2 Rabbit pAb
A17318-20ul	Abclonal	20 ul	EUR 183

NR4A2 Rabbit pAb
A17318-50ul	Abclonal	50 ul	EUR 223

Polyclonal NR4A2 Antibody (Center)
APR08823G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 (Center). This antibody is tested and proven to work in the following applications:

NR4A2 antibody
70R-18956	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NR4A2 antibody

NR4A2 Antibody
35847-100ul	SAB	100ul	EUR 252

NR4A2 antibody
10R-1497	Fitzgerald	50 ug	EUR 242
Description: Mouse monoclonal NR4A2 antibody

NR4A2 Antibody
1-CSB-PA949280	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

NR4A2 Antibody
1-CSB-PA449475	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NR4A2 Antibody
1-CSB-PA016063GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Polyclonal NURR1 (NR4A2) Antibody (N-term)
APR10842G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NURR1 (NR4A2) (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal NR4A2 antibody - C-terminal region
APR08828G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Nr4a2/ Rat Nr4a2 ELISA Kit
ELI-36911r	Lifescience Market	96 Tests	EUR 886

Nurr1/NR4A2 Antibody
DF12678	Affbiotech	200ul	EUR 304
Description: Nurr1/NR4A2 Antibody detects endogenous levels of Nurr1/NR4A2.

NR4A2 Conjugated Antibody
C35847	SAB	100ul	EUR 397

Anti-NR4A2 antibody
STJ119448	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

Anti-NR4A2 Antibody
STJ501990	St John's Laboratory	100 µg	EUR 476

Anti-NR4A2 antibody
STJ192441	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NR4A2

NR4A2 siRNA
20-abx903651	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NR4A2 siRNA
20-abx926353	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NR4A2 siRNA
20-abx926354	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti- Nurr1/NR4A2 antibody
FNab05936	FN Test	100µg	EUR 585
Immunogen: nuclear receptor subfamily 4, group A, member 2 Uniprot ID: P43354 Research Area: Neuroscience, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against Nurr1/NR4A2

Anti-Nurr1/NR4A2 antibody
PAab05936	Lifescience Market	100 ug	EUR 412

Anti-Nurr1/NR4A2 Antibody
PB9297	BosterBio	100ug/vial	EUR 294

Anti-NR4A2 Antibody (Biotin)
STJ501991	St John's Laboratory	100 µg	EUR 586

Anti-NR4A2 Antibody (FITC)
STJ501992	St John's Laboratory	100 µg	EUR 586

NR4A2 cloning plasmid
CSB-CL016063HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1797 Sequence: atgccttgtgttcaggcgcagtatgggtcctcgcctcaaggagccagccccgcttctcagagctacagttaccactcttcgggagaatacagctccgatttcttaactccagagtttgtcaagtttagcatggacctcaccaacactgaaatcactgccaccacttctctcccca Show more
Description: A cloning plasmid for the NR4A2 gene.

Anti-NR4A2 (4A6)
YF-MA20377	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to NR4A2

Nurr1/NR4A2 Blocking Peptide
DF12678-BP	Affbiotech	1mg	EUR 195

Mouse Nr4a2 ELISA KIT
ELI-16678m	Lifescience Market	96 Tests	EUR 865

Human NR4A2 ELISA KIT
ELI-22256h	Lifescience Market	96 Tests	EUR 824

Bovine NR4A2 ELISA KIT
ELI-46140b	Lifescience Market	96 Tests	EUR 928

Mouse NR4A2 shRNA Plasmid
20-abx971844	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NR4A2 shRNA Plasmid
20-abx985815	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NR4A2 shRNA Plasmid
20-abx953279	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NR4A2 Recombinant Protein (Human)
RP021625	ABM	100 ug	Ask for price

NR4A2 Recombinant Protein (Mouse)
RP154928	ABM	100 ug	Ask for price

NR4A2 Recombinant Protein (Mouse)
RP154931	ABM	100 ug	Ask for price

NR4A2 Recombinant Protein (Rat)
RP214481	ABM	100 ug	Ask for price

Intermediate-Early Receptor Protein (NR4A2) Antibody
abx235936-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Monoclonal NR4A2 Antibody (monoclonal) (M02), Clone: 1G6
APR08824G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G6. This antibody is applicable in WB and IF, E

Monoclonal NR4A2 Antibody (monoclonal) (M07), Clone: 4A6
APR08825G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 4A6. This antibody is applicable in WB and IF, E

Monoclonal NR4A2 Antibody (monoclonal) (M08), Clone: 2G5
APR08826G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2G5. This antibody is applicable in WB and IF

Monoclonal NR4A2 Antibody (monoclonal) (M10), Clone: 1C6
APR08827G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M10). The antibodies are raised in mouse and are from clone 1C6. This antibody is applicable in WB and IF, E

Nurr1/NR4A2 ELISA KIT|Human
EF001401	Lifescience Market	96 Tests	EUR 689

Nr4a2 ORF Vector (Rat) (pORF)
ORF071495	ABM	1.0 ug DNA	EUR 506

NR4A2 ORF Vector (Human) (pORF)
ORF007209	ABM	1.0 ug DNA	EUR 95

Nr4a2 ORF Vector (Mouse) (pORF)
ORF051644	ABM	1.0 ug DNA	EUR 506

Nr4a2 ORF Vector (Mouse) (pORF)
ORF051645	ABM	1.0 ug DNA	EUR 506

pECMV-Nr4a2-m-FLAG Plasmid
PVT14939	Lifescience Market	2 ug	EUR 325

pECMV-Nr4a2-m-FLAG Plasmid
PVT15055	Lifescience Market	2 ug	EUR 325

NR4A2 ELISA Kit (Mouse) (OKCA01737)
OKCA01737	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. It is crucial for expression of a set of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 1.56 pg/mL

NR4A2 ELISA Kit (Human) (OKEH03465)
OKEH03465	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. It is crucial for expression of a set of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

Nr4a2 sgRNA CRISPR Lentivector set (Rat)
K6907301	ABM	3 x 1.0 ug	EUR 339

Nr4a2 sgRNA CRISPR Lentivector set (Mouse)
K4838101	ABM	3 x 1.0 ug	EUR 339

NR4A2 sgRNA CRISPR Lentivector set (Human)
K1453201	ABM	3 x 1.0 ug	EUR 339

Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6907302	ABM	1.0 ug DNA	EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6907303	ABM	1.0 ug DNA	EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6907304	ABM	1.0 ug DNA	EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4838102	ABM	1.0 ug DNA	EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4838103	ABM	1.0 ug DNA	EUR 154

Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4838104	ABM	1.0 ug DNA	EUR 154

NR4A2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1453202	ABM	1.0 ug DNA	EUR 154

NR4A2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1453203	ABM	1.0 ug DNA	EUR 154

NR4A2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1453204	ABM	1.0 ug DNA	EUR 154

NR4A2 Protein Vector (Rat) (pPB-C-His)
PV285978	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Rat) (pPB-N-His)
PV285979	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Rat) (pPM-C-HA)
PV285980	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Rat) (pPM-C-His)
PV285981	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Mouse) (pPB-C-His)
PV206574	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Mouse) (pPB-N-His)
PV206575	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Mouse) (pPM-C-HA)
PV206576	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Mouse) (pPM-C-His)
PV206577	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Mouse) (pPB-C-His)
PV206578	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Mouse) (pPB-N-His)
PV206579	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Mouse) (pPM-C-HA)
PV206580	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Mouse) (pPM-C-His)
PV206581	ABM	500 ng	EUR 603

NR4A2 Protein Vector (Human) (pPB-C-His)
PV028833	ABM	500 ng	EUR 329

NR4A2 Protein Vector (Human) (pPB-N-His)
PV028834	ABM	500 ng	EUR 329

NR4A2 Protein Vector (Human) (pPM-C-HA)
PV028835	ABM	500 ng	EUR 329

NR4A2 Protein Vector (Human) (pPM-C-His)
PV028836	ABM	500 ng	EUR 329

Nr4a2 3'UTR Luciferase Stable Cell Line
TU114304	ABM	1.0 ml	Ask for price

Nr4a2 3'UTR GFP Stable Cell Line
TU164304	ABM	1.0 ml	Ask for price

Nr4a2 3'UTR Luciferase Stable Cell Line
TU214172	ABM	1.0 ml	Ask for price

Nr4a2 3'UTR GFP Stable Cell Line
TU264172	ABM	1.0 ml	Ask for price

NR4A2 3'UTR GFP Stable Cell Line
TU065951	ABM	1.0 ml	EUR 1394

NR4A2 3'UTR Luciferase Stable Cell Line
TU015951	ABM	1.0 ml	EUR 1394

Nuclear receptor subfamily 4 group A member 2 (NR4A2) Antibody
20-abx213782	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Nuclear Receptor Subfamily 4, Group A, Member 2 (NR4A2) Antibody
20-abx114199	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Nuclear receptor subfamily 4 group A member 2 (NR4A2) Antibody
20-abx241582	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

NR4A2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV695053	ABM	1.0 ug DNA	EUR 682

NR4A2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV695057	ABM	1.0 ug DNA	EUR 682

NR4A2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV695058	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NR4A2 Rabbit Polyclonal Antibody