PDYN Rabbit Polyclonal Antibody

PDYN Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PDYN Polyclonal Antibody
ES11431-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PDYN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PDYN Polyclonal Antibody
ABP59873-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
PDYN Polyclonal Antibody
ABP59873-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
PDYN Polyclonal Antibody
ABP59873-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
PDYN Polyclonal Antibody
30667-100ul 100ul
EUR 252
PDYN Polyclonal Antibody
30667-50ul 50ul
EUR 187
PDYN Rabbit pAb
A5830-100ul 100 ul
EUR 308
PDYN Rabbit pAb
A5830-200ul 200 ul
EUR 459
PDYN Rabbit pAb
A5830-20ul 20 ul
EUR 183
PDYN Rabbit pAb
A5830-50ul 50 ul
EUR 223
PDYN Polyclonal Conjugated Antibody
C30667 100ul
EUR 397
Pdyn antibody
70R-9818 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Pdyn antibody
PDYN antibody
23050-100ul 100ul
EUR 390
PDYN antibody
70R-13546 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PDYN antibody
Prodynorphin (PDYN) Antibody
20-abx142135
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Prodynorphin (PDYN) Antibody
20-abx006315
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Prodynorphin (PDYN) Antibody
abx412427-01ml 0.1 ml
EUR 578
  • Shipped within 1 week.
Anti-PDYN antibody
STJ28393 100 µl
EUR 277
Description: The protein encoded by this gene is a preproprotein that is proteolytically processed to form the secreted opioid peptides beta-neoendorphin, dynorphin, leu-enkephalin, rimorphin, and leumorphin. These peptides are ligands for the kappa-type of opioid receptor. Dynorphin is involved in modulating responses to several psychoactive substances, including cocaine. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene.
Anti-PDYN antibody
STJ192589 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PDYN
Pdyn/ Rat Pdyn ELISA Kit
ELI-03278r 96 Tests
EUR 886
Rabbit Proenkephalin B(PDYN) ELISA kit
E04P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Proenkephalin B(PDYN) ELISA kit
E04P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Proenkephalin B(PDYN) ELISA kit
E04P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
PDYN cloning plasmid
CSB-CL017750HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggcctggcaggggctggtcctggctgcctgcctcctcatgttcccctccaccacagcggactgcctgtcgcggtgctccttgtgtgctgtaaagacccaggatggtcccaaacctatcaatcccctgatttgctccctgcaatgccaggctgccctgctgccctctgaggaatg
  • Show more
Description: A cloning plasmid for the PDYN gene.
Pdyn Blocking Peptide
33R-9191 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pdyn antibody, catalog no. 70R-9818
Dynorphin A (Dyn1-17/PDYN) Antibody
abx412425-01ml 0.1 ml
EUR 578
  • Shipped within 1 week.
Dynorphin B (Dyn1-13/PDYN) Antibody
abx412426-01ml 0.1 ml
EUR 578
  • Shipped within 1 week.
Human PDYN ELISA Kit
ELA-E10214h 96 Tests
EUR 824
PDYN ELISA KIT|Human
EF002075 96 Tests
EUR 689
Human PDYN shRNA Plasmid
20-abx953452
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PDYN Recombinant Protein (Human)
RP023017 100 ug Ask for price
PDYN Recombinant Protein (Rat)
RP219965 100 ug Ask for price
PDYN Recombinant Protein (Mouse)
RP161207 100 ug Ask for price
PDYN ORF Vector (Human) (pORF)
ORF007673 1.0 ug DNA
EUR 95
Pdyn ORF Vector (Rat) (pORF)
ORF073323 1.0 ug DNA
EUR 506
Pdyn ORF Vector (Mouse) (pORF)
ORF053737 1.0 ug DNA
EUR 506
Human Prodynorphin(PDYN)ELISA Kit
QY-E01888 96T
EUR 361
PDYN ELISA Kit (Rat) (OKEH03583)
OKEH03583 96 Wells
EUR 779
Description: Description of target: Leu-enkephalins compete with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress. Dynorphin peptides differentially regulate the kappa opioid receptor. Dynorphin A(1-13) has a typical opiod activity, it is 700 times more potent than Leu-enkephalin. Leumorphin has a typical opiod activity and may have anti-apoptotic effect.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL
PDYN ELISA Kit (Bovine) (OKEH07559)
OKEH07559 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
PDYN ELISA Kit (Pig) (OKEH07560)
OKEH07560 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
Cow Proenkephalin-B (PDYN) ELISA Kit
abx514688-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Proenkephalin-B (PDYN) ELISA Kit
abx514690-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Pig Proenkephalin-B (PDYN) ELISA Kit
abx514691-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Proenkephalin B(PDYN) ELISA kit
E02P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Proenkephalin B(PDYN) ELISA kit
E02P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Proenkephalin B(PDYN) ELISA kit
E02P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PDYN Rabbit Polyclonal Antibody