PARP6 Rabbit Polyclonal Antibody

PARP6 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PARP6 Polyclonal Antibody
ABP59833-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PARP6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PARP6 from Human, Mouse. This PARP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP6 protein
PARP6 Polyclonal Antibody
ABP59833-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PARP6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PARP6 from Human, Mouse. This PARP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP6 protein
PARP6 Polyclonal Antibody
ES10960-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PARP6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PARP6 Polyclonal Antibody
ES10960-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PARP6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PARP6 antibody
70R-19120 50 ul
EUR 435
Description: Rabbit polyclonal PARP6 antibody
PARP6 antibody
70R-1039 100 ug
EUR 377
Description: Rabbit polyclonal PARP6 antibody
PARP6 antibody
70R-2153 50 ug
EUR 467
Description: Rabbit polyclonal PARP6 antibody
PARP6 Antibody
1-CSB-PA017470GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PARP6. Recognizes PARP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
PARP6 antibody
70R-8007 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PARP6 antibody
anti- PARP6 antibody
FNab06159 100µg
EUR 505.25
  • Immunogen: poly(ADP-ribose) polymerase family, member 6
  • Uniprot ID: Q2NL67
  • Gene ID: 56965
  • Research Area: Metabolism
Description: Antibody raised against PARP6
Anti-PARP6 antibody
PAab06159 100 ug
EUR 355
Anti-PARP6 antibody
STJ192118 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PARP6
PARP6 siRNA
20-abx927767
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PARP6 siRNA
20-abx927768
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PARP6 Blocking Peptide
33R-3755 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP6 antibody, catalog no. 70R-1039
PARP6 Blocking Peptide
33R-4528 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP6 antibody, catalog no. 70R-2153
PARP6 Blocking Peptide
33R-5840 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP6 antibody, catalog no. 70R-8007
PARP6 cloning plasmid
CSB-CL647549HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 330
  • Sequence: atgggaaaaggacagcacaggatgccctccaaggatgagctggtccagagatacaacaggatgaataccatcccccagacccgatccattcagtcacggttcctgcagagtcggaatctaaactgtatagcactttgtgaagtgattacatctaaggacctccagaagcatgggaa
  • Show more
Description: A cloning plasmid for the PARP6 gene.
PARP6 cloning plasmid
CSB-CL647549HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atgtttacatcccaacaatggaaacatctgagcaatgatttcttgaagacccagcaggagaagaggcacagttggttcaaggcaagtggtaccatcaagaagttccgagctggcctcagcatcttttcacccatccccaagtctcccagtttccctatcatacaggactccatgc
  • Show more
Description: A cloning plasmid for the PARP6 gene.
PARP6 ELISA KIT|Human
EF001568 96 Tests
EUR 689
Mouse PARP6 shRNA Plasmid
20-abx976080
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PARP6 shRNA Plasmid
20-abx961259
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PARP6 Recombinant Protein (Human)
RP022594 100 ug Ask for price
PARP6 Recombinant Protein (Human)
RP022597 100 ug Ask for price
PARP6 Recombinant Protein (Mouse)
RP160199 100 ug Ask for price
PARP6 Recombinant Protein (Mouse)
RP160202 100 ug Ask for price
PARP6 Recombinant Protein (Rat)
RP219347 100 ug Ask for price
Poly ADP Ribose Polymerase 6 (PARP6) Antibody
abx031373-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Poly ADP Ribose Polymerase 6 (PARP6) Antibody
abx031373-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Poly ADP Ribose Polymerase 6 (Parp6) Antibody
abx032783-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Poly ADP Ribose Polymerase 6 (Parp6) Antibody
abx032783-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Poly ADP Ribose Polymerase 6 (PARP6) Antibody
abx236159-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Parp6 ORF Vector (Rat) (pORF)
ORF073117 1.0 ug DNA
EUR 506
PARP6 ORF Vector (Human) (pORF)
ORF007532 1.0 ug DNA
EUR 95
PARP6 ORF Vector (Human) (pORF)
ORF007533 1.0 ug DNA
EUR 95
Parp6 ORF Vector (Mouse) (pORF)
ORF053401 1.0 ug DNA
EUR 506
Parp6 ORF Vector (Mouse) (pORF)
ORF053402 1.0 ug DNA
EUR 506
Parp6 sgRNA CRISPR Lentivector set (Rat)
K6583201 3 x 1.0 ug
EUR 339
Parp6 sgRNA CRISPR Lentivector set (Mouse)
K4575201 3 x 1.0 ug
EUR 339
PARP6 sgRNA CRISPR Lentivector set (Human)
K1596001 3 x 1.0 ug
EUR 339
Parp6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6583202 1.0 ug DNA
EUR 154
Parp6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6583203 1.0 ug DNA
EUR 154
Parp6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6583204 1.0 ug DNA
EUR 154

PARP6 Rabbit Polyclonal Antibody