CPXM1 Rabbit Polyclonal Antibody

CPXM1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

CPXM1 Polyclonal Antibody

ABP58257-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CPXM1 protein at amino acid sequence of 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of CPXM1 from Human, Mouse. This CPXM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CPXM1 protein at amino acid sequence of 350-430

CPXM1 Polyclonal Antibody

ES11178-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CPXM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CPXM1 Polyclonal Antibody

ES11178-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CPXM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CPXM1 Rabbit pAb

A16552-100ul 100 ul
EUR 308

CPXM1 Rabbit pAb

A16552-200ul 200 ul
EUR 459

CPXM1 Rabbit pAb

A16552-20ul 20 ul
EUR 183

CPXM1 Rabbit pAb

A16552-50ul 50 ul
EUR 223

CPXM1 Polyclonal Conjugated Antibody

C29878 100ul
EUR 397

Polyclonal CPXM1 antibody - middle region

APR01354G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CPXM1 - middle region. This antibody is tested and proven to work in the following applications:

Anti-CPXM1 antibody

STJ118991 100 µl
EUR 277

Anti-CPXM1 antibody

STJ192336 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CPXM1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CPXM1 cloning plasmid

CSB-CL836302HU-10ug 10ug
EUR 409
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgtgggggctcctgctcgccctggccgccttcgcgccggccgtcggcccggctctgggggcgcccaggaactcggtgctgggcctcgcgcagcccgggaccaccaaggtcccaggctcgaccccggccctgcatagcagcccggcacagccgccggcggagacagctaacggga
  • Show more
Description: A cloning plasmid for the CPXM1 gene.

Mouse CPXM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CPXM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CPXM1 Recombinant Protein (Human)

RP007936 100 ug Ask for price

CPXM1 Recombinant Protein (Rat)

RP196187 100 ug Ask for price

CPXM1 Recombinant Protein (Mouse)

RP125870 100 ug Ask for price

Cpxm1 ORF Vector (Rat) (pORF)

ORF065397 1.0 ug DNA
EUR 506

CPXM1 ORF Vector (Human) (pORF)

ORF002646 1.0 ug DNA
EUR 95

Cpxm1 ORF Vector (Mouse) (pORF)

ORF041958 1.0 ug DNA
EUR 506

CPXM1 sgRNA CRISPR Lentivector set (Human)

K0503401 3 x 1.0 ug
EUR 339

Cpxm1 sgRNA CRISPR Lentivector set (Rat)

K6223001 3 x 1.0 ug
EUR 339

Cpxm1 sgRNA CRISPR Lentivector set (Mouse)

K3817201 3 x 1.0 ug
EUR 339

Human Probable carboxypeptidase X1, CPXM1 ELISA KIT

ELI-50458h 96 Tests
EUR 824

Mouse Probable carboxypeptidase X1, Cpxm1 ELISA KIT

ELI-50582m 96 Tests
EUR 865

CPXM1 Rabbit Polyclonal Antibody