CPXM1 Rabbit Polyclonal Antibody
CPXM1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
CPXM1 Polyclonal Antibody |
ABP58257-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CPXM1 protein at amino acid sequence of 350-430
- Applications tips:
|
Description: A polyclonal antibody for detection of CPXM1 from Human, Mouse. This CPXM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CPXM1 protein at amino acid sequence of 350-430 |
CPXM1 Polyclonal Antibody |
ES11178-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CPXM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CPXM1 Polyclonal Antibody |
ES11178-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CPXM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CPXM1 Rabbit pAb |
A16552-100ul |
Abclonal |
100 ul |
EUR 308 |
CPXM1 Rabbit pAb |
A16552-200ul |
Abclonal |
200 ul |
EUR 459 |
CPXM1 Rabbit pAb |
A16552-20ul |
Abclonal |
20 ul |
EUR 183 |
CPXM1 Rabbit pAb |
A16552-50ul |
Abclonal |
50 ul |
EUR 223 |
CPXM1 Polyclonal Conjugated Antibody |
C29878 |
SAB |
100ul |
EUR 397 |
Polyclonal CPXM1 antibody - middle region |
APR01354G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CPXM1 - middle region. This antibody is tested and proven to work in the following applications: |
Anti-CPXM1 antibody |
STJ192336 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CPXM1 |
CPXM1 siRNA |
20-abx912730 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CPXM1 siRNA |
20-abx912731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CPXM1 cloning plasmid |
CSB-CL836302HU-10ug |
Cusabio |
10ug |
EUR 409 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1071
- Sequence: atgtgggggctcctgctcgccctggccgccttcgcgccggccgtcggcccggctctgggggcgcccaggaactcggtgctgggcctcgcgcagcccgggaccaccaaggtcccaggctcgaccccggccctgcatagcagcccggcacagccgccggcggagacagctaacggga
- Show more
|
Description: A cloning plasmid for the CPXM1 gene. |
Mouse CPXM1 shRNA Plasmid |
20-abx974668 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CPXM1 shRNA Plasmid |
20-abx961124 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CPXM1 Recombinant Protein (Human) |
RP007936 |
ABM |
100 ug |
Ask for price |
CPXM1 Recombinant Protein (Rat) |
RP196187 |
ABM |
100 ug |
Ask for price |
CPXM1 Recombinant Protein (Mouse) |
RP125870 |
ABM |
100 ug |
Ask for price |
Cpxm1 ORF Vector (Rat) (pORF) |
ORF065397 |
ABM |
1.0 ug DNA |
EUR 506 |
CPXM1 ORF Vector (Human) (pORF) |
ORF002646 |
ABM |
1.0 ug DNA |
EUR 95 |
Cpxm1 ORF Vector (Mouse) (pORF) |
ORF041958 |
ABM |
1.0 ug DNA |
EUR 506 |
CPXM1 sgRNA CRISPR Lentivector set (Human) |
K0503401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cpxm1 sgRNA CRISPR Lentivector set (Rat) |
K6223001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cpxm1 sgRNA CRISPR Lentivector set (Mouse) |
K3817201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Probable carboxypeptidase X1, CPXM1 ELISA KIT |
ELI-50458h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Probable carboxypeptidase X1, Cpxm1 ELISA KIT |
ELI-50582m |
Lifescience Market |
96 Tests |
EUR 865 |
CPXM1 Rabbit Polyclonal Antibody