DISP1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

DISP1 Polyclonal Antibody
ABP58376-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350 Applications tips:
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350

DISP1 Polyclonal Antibody
ABP58376-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350 Applications tips:
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350

DISP1 Polyclonal Antibody
28772-100ul	SAB	100ul	EUR 252

DISP1 Polyclonal Antibody
28772-50ul	SAB	50ul	EUR 187

DISP1 Rabbit pAb
A14946-100ul	Abclonal	100 ul	EUR 308

DISP1 Rabbit pAb
A14946-200ul	Abclonal	200 ul	EUR 459

DISP1 Rabbit pAb
A14946-20ul	Abclonal	20 ul	EUR 183

DISP1 Rabbit pAb
A14946-50ul	Abclonal	50 ul	EUR 223

DISP1 Polyclonal Conjugated Antibody
C28772	SAB	100ul	EUR 397

DISP1 antibody
70R-6341	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DISP1 antibody

DISP1 Antibody
25400-100ul	SAB	100ul	EUR 390

DISP1 antibody
70R-16842	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DISP1 antibody

DISP1 Antibody
1-CSB-PA006916GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DISP1. Recognizes DISP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal DISP1 antibody - middle region
APR11736G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal DISPA / DISP1 Antibody (N-Terminus)
APR11737G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISPA / DISP1 (N-Terminus). This antibody is tested and proven to work in the following applications:

anti- DISP1 antibody
FNab02398	FN Test	100µg	EUR 585
Immunogen: dispatched homolog 1(Drosophila) Uniprot ID: Q96F81 Gene ID: 84976 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against DISP1

Anti-DISP1 antibody
PAab02398	Lifescience Market	100 ug	EUR 412

Anti-DISP1 antibody
STJ117145	St John's Laboratory	100 µl	EUR 277
Description: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo.

Anti-DISP1 antibody
STJ192460	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DISP1

DISP1 siRNA
20-abx914188	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DISP1 siRNA
20-abx914189	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse)
4-PAN612Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1)

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC
4-PAN612Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAN612Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Biotin.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Cy3
4-PAN612Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Cy3.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), FITC
4-PAN612Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with FITC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), HRP
4-PAN612Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with HRP.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), PE
4-PAN612Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with PE.

DISP1 Blocking Peptide
33R-3115	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISP1 antibody, catalog no. 70R-6341

DISP1 cloning plasmid
CSB-CL839320HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1629 Sequence: atggctatgagcaatggaaacaatgattttgtggttctgagcaacagcagcatcgcaaccagtgctgctaacccgagtcccctcaccccctgtgatggagaccatgcagcccagcagctcacacccaaagaagcaacaagaacaaaagtgagtccaaatggatgcctgcaactta Show more
Description: A cloning plasmid for the DISP1 gene.

DISP1 cloning plasmid
CSB-CL839320HU1-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2754 Sequence: atgttcgtcaccagttttaccactgctgctgccttttatgctaactatgttagcaacattacagcaatccgatgctttggggtttatgcggggacagctatattggtgaattacgttttgatggtcacatggcttccagcagttgttgtgctgcatgagcggtatcttcttaata Show more
Description: A cloning plasmid for the DISP1 gene.

pCMV-SPORT6-DISP1
PVT13099	Lifescience Market	2 ug	EUR 391

Dispatched Homolog 1 (DISP1) Antibody
20-abx112105	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Antibody
20-abx102141	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dispatched Homolog 1 (DISP1) Antibody
abx432607-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAN612Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC-Cy7.

Mouse DISP1 shRNA Plasmid
20-abx976776	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DISP1 shRNA Plasmid
20-abx963739	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DISP1 ELISA KIT|Human
EF009119	Lifescience Market	96 Tests	EUR 689

Protein Dispatched Homolog 1 (DISP1) Antibody
abx232398-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DISP1 ORF Vector (Human) (pORF)
ORF003127	ABM	1.0 ug DNA	EUR 95

DISP1 ORF Vector (Human) (pORF)
ORF003128	ABM	1.0 ug DNA	EUR 95

Disp1 ORF Vector (Rat) (pORF)
ORF066034	ABM	1.0 ug DNA	EUR 2080

Disp1 ORF Vector (Mouse) (pORF)
ORF043040	ABM	1.0 ug DNA	EUR 1572

Recombinant Dispatched Homolog 1 (DISP1)
4-RPN612Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q3TDN0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.2kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Dispatched Homolog 1 expressed in: E.coli

DISP1 sgRNA CRISPR Lentivector set (Human)
K0604701	ABM	3 x 1.0 ug	EUR 339

Mouse Dispatched Homolog 1 (DISP1) Protein
20-abx066351	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Disp1 sgRNA CRISPR Lentivector set (Mouse)
K3768101	ABM	3 x 1.0 ug	EUR 339

Disp1 sgRNA CRISPR Lentivector set (Rat)
K6452601	ABM	3 x 1.0 ug	EUR 339

DISP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0604702	ABM	1.0 ug DNA	EUR 154

DISP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0604703	ABM	1.0 ug DNA	EUR 154

DISP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0604704	ABM	1.0 ug DNA	EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3768102	ABM	1.0 ug DNA	EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3768103	ABM	1.0 ug DNA	EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3768104	ABM	1.0 ug DNA	EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6452602	ABM	1.0 ug DNA	EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6452603	ABM	1.0 ug DNA	EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6452604	ABM	1.0 ug DNA	EUR 154

DISP1 Protein Vector (Human) (pPB-C-His)
PV012505	ABM	500 ng	EUR 329

DISP1 Protein Vector (Human) (pPB-N-His)
PV012506	ABM	500 ng	EUR 329

DISP1 Protein Vector (Human) (pPM-C-HA)
PV012507	ABM	500 ng	EUR 329

DISP1 Protein Vector (Human) (pPM-C-His)
PV012508	ABM	500 ng	EUR 329

DISP1 Protein Vector (Human) (pPB-C-His)
PV012509	ABM	500 ng	EUR 329

DISP1 Protein Vector (Human) (pPB-N-His)
PV012510	ABM	500 ng	EUR 329

DISP1 Protein Vector (Human) (pPM-C-HA)
PV012511	ABM	500 ng	EUR 329

DISP1 Protein Vector (Human) (pPM-C-His)
PV012512	ABM	500 ng	EUR 329

DISP1 Protein Vector (Mouse) (pPB-C-His)
PV172158	ABM	500 ng	EUR 2570

DISP1 Protein Vector (Mouse) (pPB-N-His)
PV172159	ABM	500 ng	EUR 2570

DISP1 Protein Vector (Mouse) (pPM-C-HA)
PV172160	ABM	500 ng	EUR 2570

DISP1 Protein Vector (Mouse) (pPM-C-His)
PV172161	ABM	500 ng	EUR 2570

DISP1 Protein Vector (Rat) (pPB-C-His)
PV264134	ABM	500 ng	EUR 2571

DISP1 Protein Vector (Rat) (pPB-N-His)
PV264135	ABM	500 ng	EUR 2571

DISP1 Protein Vector (Rat) (pPM-C-HA)
PV264136	ABM	500 ng	EUR 2571

DISP1 Protein Vector (Rat) (pPM-C-His)
PV264137	ABM	500 ng	EUR 2571

Disp1 3'UTR Luciferase Stable Cell Line
TU203429	ABM	1.0 ml	Ask for price

Disp1 3'UTR GFP Stable Cell Line
TU155165	ABM	1.0 ml	Ask for price

DISP1 3'UTR Luciferase Stable Cell Line
TU006037	ABM	1.0 ml	EUR 1394

Disp1 3'UTR Luciferase Stable Cell Line
TU105165	ABM	1.0 ml	Ask for price

DISP1 3'UTR GFP Stable Cell Line
TU056037	ABM	1.0 ml	EUR 1394

Disp1 3'UTR GFP Stable Cell Line
TU253429	ABM	1.0 ml	Ask for price

Mouse Protein dispatched homolog 1, Disp1 ELISA KIT
ELI-26868m	Lifescience Market	96 Tests	EUR 865

Human Protein dispatched homolog 1, DISP1 ELISA KIT
ELI-31941h	Lifescience Market	96 Tests	EUR 824

Human Protein dispatched homolog 1 (DISP1) ELISA Kit
abx386894-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Protein dispatched homolog 1 (DISP1) ELISA Kit
abx389081-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

DISP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV653173	ABM	1.0 ug DNA	EUR 2402

DISP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV653177	ABM	1.0 ug DNA	EUR 2402

DISP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV653178	ABM	1.0 ug DNA	EUR 2402

DISP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV709323	ABM	1.0 ug DNA	EUR 316

DISP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV709327	ABM	1.0 ug DNA	EUR 316

DISP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV709328	ABM	1.0 ug DNA	EUR 316

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

DISP1 Rabbit Polyclonal Antibody