DISP1 Rabbit Polyclonal Antibody
DISP1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
 DISP1 Polyclonal Antibody |
|
ABP58376-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350 |
DISP1 Polyclonal Antibody |
|
ABP58376-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350 |
DISP1 Polyclonal Antibody |
|
28772-100ul |
SAB |
100ul |
EUR 252 |
DISP1 Polyclonal Antibody |
|
28772-50ul |
SAB |
50ul |
EUR 187 |
 DISP1 Rabbit pAb |
|
A14946-100ul |
Abclonal |
100 ul |
EUR 308 |
DISP1 Rabbit pAb |
|
A14946-200ul |
Abclonal |
200 ul |
EUR 459 |
DISP1 Rabbit pAb |
|
A14946-20ul |
Abclonal |
20 ul |
EUR 183 |
DISP1 Rabbit pAb |
|
A14946-50ul |
Abclonal |
50 ul |
EUR 223 |
 DISP1 Polyclonal Conjugated Antibody |
|
C28772 |
SAB |
100ul |
EUR 397 |
 DISP1 antibody |
|
70R-6341 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal DISP1 antibody |
 DISP1 Antibody |
|
25400-100ul |
SAB |
100ul |
EUR 390 |
DISP1 antibody |
|
70R-16842 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal DISP1 antibody |
DISP1 Antibody |
|
1-CSB-PA006916GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against DISP1. Recognizes DISP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 Polyclonal DISP1 antibody - middle region |
|
APR11736G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 - middle region. This antibody is tested and proven to work in the following applications: |
) Polyclonal DISPA / DISP1 Antibody (N-Terminus) |
|
APR11737G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISPA / DISP1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
 anti- DISP1 antibody |
|
FNab02398 |
FN Test |
100µg |
EUR 585 |
- Immunogen: dispatched homolog 1(Drosophila)
- Uniprot ID: Q96F81
- Gene ID: 84976
- Research Area: Neuroscience, Developmental biology
|
|
Description: Antibody raised against DISP1 |
 Anti-DISP1 antibody |
|
STJ117145 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. |
Anti-DISP1 antibody |
|
STJ192460 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DISP1 |
 DISP1 siRNA |
|
20-abx914188 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DISP1 siRNA |
|
20-abx914189 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Mouse)) Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse) |
|
4-PAN612Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1) |
 Polyclonal Antibody (Mouse), APC) Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC |
|
4-PAN612Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC. |
 Polyclonal Antibody (Mouse), Biotinylated) Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Biotinylated |
|
4-PAN612Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Mouse), Cy3) Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Cy3 |
|
4-PAN612Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Mouse), FITC) Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), FITC |
|
4-PAN612Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Mouse), HRP) Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), HRP |
|
4-PAN612Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Mouse), PE) Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), PE |
|
4-PAN612Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with PE. |
 DISP1 Blocking Peptide |
|
33R-3115 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISP1 antibody, catalog no. 70R-6341 |
 DISP1 cloning plasmid |
|
CSB-CL839320HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1629
- Sequence: atggctatgagcaatggaaacaatgattttgtggttctgagcaacagcagcatcgcaaccagtgctgctaacccgagtcccctcaccccctgtgatggagaccatgcagcccagcagctcacacccaaagaagcaacaagaacaaaagtgagtccaaatggatgcctgcaactta
- Show more
|
|
Description: A cloning plasmid for the DISP1 gene. |
DISP1 cloning plasmid |
|
CSB-CL839320HU1-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2754
- Sequence: atgttcgtcaccagttttaccactgctgctgccttttatgctaactatgttagcaacattacagcaatccgatgctttggggtttatgcggggacagctatattggtgaattacgttttgatggtcacatggcttccagcagttgttgtgctgcatgagcggtatcttcttaata
- Show more
|
|
Description: A cloning plasmid for the DISP1 gene. |
 Antibody) Dispatched Homolog 1 (DISP1) Antibody |
|
20-abx112105 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dispatched Homolog 1 (DISP1) Antibody |
|
20-abx102141 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dispatched Homolog 1 (DISP1) Antibody |
|
abx432607-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 Polyclonal Antibody (Mouse), APC-Cy7) Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC-Cy7 |
|
4-PAN612Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC-Cy7. |
 Mouse DISP1 shRNA Plasmid |
|
20-abx976776 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human DISP1 shRNA Plasmid |
|
20-abx963739 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Protein Dispatched Homolog 1 (DISP1) Antibody |
|
abx232398-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
 (pORF)) DISP1 ORF Vector (Human) (pORF) |
|
ORF003127 |
ABM |
1.0 ug DNA |
EUR 95 |
DISP1 ORF Vector (Human) (pORF) |
|
ORF003128 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Disp1 ORF Vector (Rat) (pORF) |
|
ORF066034 |
ABM |
1.0 ug DNA |
EUR 2080 |
 (pORF)) Disp1 ORF Vector (Mouse) (pORF) |
|
ORF043040 |
ABM |
1.0 ug DNA |
EUR 1572 |
) Recombinant Dispatched Homolog 1 (DISP1) |
|
4-RPN612Mu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q3TDN0
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 36.2kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Mouse Dispatched Homolog 1 expressed in: E.coli |
) DISP1 sgRNA CRISPR Lentivector set (Human) |
|
K0604701 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Protein) Mouse Dispatched Homolog 1 (DISP1) Protein |
|
20-abx066351 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
) Disp1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3768101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Disp1 sgRNA CRISPR Lentivector set (Rat) |
|
K6452601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) DISP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0604702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DISP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0604703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DISP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0604704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3768102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3768103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3768104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Disp1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6452602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Disp1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6452603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Disp1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6452604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) DISP1 Protein Vector (Human) (pPB-C-His) |
|
PV012505 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) DISP1 Protein Vector (Human) (pPB-N-His) |
|
PV012506 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) DISP1 Protein Vector (Human) (pPM-C-HA) |
|
PV012507 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) DISP1 Protein Vector (Human) (pPM-C-His) |
|
PV012508 |
ABM |
500 ng |
EUR 329 |
DISP1 Protein Vector (Human) (pPB-C-His) |
|
PV012509 |
ABM |
500 ng |
EUR 329 |
DISP1 Protein Vector (Human) (pPB-N-His) |
|
PV012510 |
ABM |
500 ng |
EUR 329 |
DISP1 Protein Vector (Human) (pPM-C-HA) |
|
PV012511 |
ABM |
500 ng |
EUR 329 |
DISP1 Protein Vector (Human) (pPM-C-His) |
|
PV012512 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) DISP1 Protein Vector (Mouse) (pPB-C-His) |
|
PV172158 |
ABM |
500 ng |
EUR 2570 |
 (pPB-N-His)) DISP1 Protein Vector (Mouse) (pPB-N-His) |
|
PV172159 |
ABM |
500 ng |
EUR 2570 |
 (pPM-C-HA)) DISP1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV172160 |
ABM |
500 ng |
EUR 2570 |
 (pPM-C-His)) DISP1 Protein Vector (Mouse) (pPM-C-His) |
|
PV172161 |
ABM |
500 ng |
EUR 2570 |
 (pPB-C-His)) DISP1 Protein Vector (Rat) (pPB-C-His) |
|
PV264134 |
ABM |
500 ng |
EUR 2571 |
 (pPB-N-His)) DISP1 Protein Vector (Rat) (pPB-N-His) |
|
PV264135 |
ABM |
500 ng |
EUR 2571 |
 (pPM-C-HA)) DISP1 Protein Vector (Rat) (pPM-C-HA) |
|
PV264136 |
ABM |
500 ng |
EUR 2571 |
 (pPM-C-His)) DISP1 Protein Vector (Rat) (pPM-C-His) |
|
PV264137 |
ABM |
500 ng |
EUR 2571 |
 Disp1 3'UTR Luciferase Stable Cell Line |
|
TU203429 |
ABM |
1.0 ml |
Ask for price |
 Disp1 3'UTR GFP Stable Cell Line |
|
TU155165 |
ABM |
1.0 ml |
Ask for price |
 DISP1 3'UTR Luciferase Stable Cell Line |
|
TU006037 |
ABM |
1.0 ml |
EUR 1394 |
Disp1 3'UTR Luciferase Stable Cell Line |
|
TU105165 |
ABM |
1.0 ml |
Ask for price |
 DISP1 3'UTR GFP Stable Cell Line |
|
TU056037 |
ABM |
1.0 ml |
EUR 1394 |
Disp1 3'UTR GFP Stable Cell Line |
|
TU253429 |
ABM |
1.0 ml |
Ask for price |
 Mouse Protein dispatched homolog 1, Disp1 ELISA KIT |
|
ELI-26868m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Protein dispatched homolog 1, DISP1 ELISA KIT |
|
ELI-31941h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit) Human Protein dispatched homolog 1 (DISP1) ELISA Kit |
|
abx386894-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Protein dispatched homolog 1 (DISP1) ELISA Kit |
|
abx389081-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV)) DISP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV653173 |
ABM |
1.0 ug DNA |
EUR 2402 |
 (UbC) (pLenti-GIII-UbC)) DISP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV653177 |
ABM |
1.0 ug DNA |
EUR 2402 |
 (EF1a) (pLenti-GIII-EF1a)) DISP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV653178 |
ABM |
1.0 ug DNA |
EUR 2402 |
 (CMV) (pLenti-GIII-CMV)) DISP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV709323 |
ABM |
1.0 ug DNA |
EUR 316 |
 (UbC) (pLenti-GIII-UbC)) DISP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV709327 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) DISP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV709328 |
ABM |
1.0 ug DNA |
EUR 316 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
DISP1 Rabbit Polyclonal Antibody
