DISP1 Rabbit Polyclonal Antibody

DISP1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

DISP1 Polyclonal Antibody

ABP58376-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350

Polyclonal DISP1 Antibody

APR11735G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 . This antibody is tested and proven to work in the following applications:

DISP1 Polyclonal Antibody

ES11302-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DISP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DISP1 Polyclonal Antibody

ES11302-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DISP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DISP1 Rabbit pAb

A14946-100ul 100 ul
EUR 308

DISP1 Rabbit pAb

A14946-200ul 200 ul
EUR 459

DISP1 Rabbit pAb

A14946-20ul 20 ul
EUR 183

DISP1 Rabbit pAb

A14946-50ul 50 ul
EUR 223

DISP1 Polyclonal Conjugated Antibody

C28772 100ul
EUR 397

DISP1 Antibody

25400-100ul 100ul
EUR 390

DISP1 antibody

70R-16842 50 ul
EUR 435
Description: Rabbit polyclonal DISP1 antibody

DISP1 Antibody

1-CSB-PA006916GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DISP1. Recognizes DISP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DISP1 antibody

70R-6341 50 ug
EUR 467
Description: Rabbit polyclonal DISP1 antibody

Polyclonal DISP1 antibody - middle region

APR11736G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal DISPA / DISP1 Antibody (N-Terminus)

APR11737G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISPA / DISP1 (N-Terminus). This antibody is tested and proven to work in the following applications:

anti- DISP1 antibody

FNab02398 100µg
EUR 585
  • Immunogen: dispatched homolog 1(Drosophila)
  • Uniprot ID: Q96F81
  • Gene ID: 84976
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against DISP1

Anti-DISP1 antibody

PAab02398 100 ug
EUR 412

Anti-DISP1 antibody

STJ117145 100 µl
EUR 277
Description: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo.

Anti-DISP1 antibody

STJ192460 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DISP1

DISP1 siRNA

20-abx914188
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DISP1 siRNA

20-abx914189
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse)

4-PAN612Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1)

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC

4-PAN612Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Biotinylated

4-PAN612Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Biotin.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Cy3

4-PAN612Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Cy3.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), FITC

4-PAN612Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with FITC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), HRP

4-PAN612Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with HRP.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), PE

4-PAN612Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with PE.

DISP1 Blocking Peptide

33R-3115 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISP1 antibody, catalog no. 70R-6341

DISP1 cloning plasmid

CSB-CL839320HU1-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2754
  • Sequence: atgttcgtcaccagttttaccactgctgctgccttttatgctaactatgttagcaacattacagcaatccgatgctttggggtttatgcggggacagctatattggtgaattacgttttgatggtcacatggcttccagcagttgttgtgctgcatgagcggtatcttcttaata
  • Show more
Description: A cloning plasmid for the DISP1 gene.

DISP1 cloning plasmid

CSB-CL839320HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1629
  • Sequence: atggctatgagcaatggaaacaatgattttgtggttctgagcaacagcagcatcgcaaccagtgctgctaacccgagtcccctcaccccctgtgatggagaccatgcagcccagcagctcacacccaaagaagcaacaagaacaaaagtgagtccaaatggatgcctgcaactta
  • Show more
Description: A cloning plasmid for the DISP1 gene.

pCMV-SPORT6-DISP1

PVT13099 2 ug
EUR 391

Dispatched Homolog 1 (DISP1) Antibody

20-abx102141
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dispatched Homolog 1 (DISP1) Antibody

20-abx112105
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Antibody

abx432607-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAN612Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC-Cy7.

DISP1 ELISA KIT|Human

EF009119 96 Tests
EUR 689

Mouse DISP1 shRNA Plasmid

20-abx976776
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DISP1 shRNA Plasmid

20-abx963739
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Protein Dispatched Homolog 1 (DISP1) Antibody

abx232398-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Disp1 ORF Vector (Rat) (pORF)

ORF066034 1.0 ug DNA
EUR 2080

DISP1 ORF Vector (Human) (pORF)

ORF003127 1.0 ug DNA
EUR 95

DISP1 ORF Vector (Human) (pORF)

ORF003128 1.0 ug DNA
EUR 95

Disp1 ORF Vector (Mouse) (pORF)

ORF043040 1.0 ug DNA
EUR 1572

Recombinant Dispatched Homolog 1 (DISP1)

4-RPN612Mu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3TDN0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Dispatched Homolog 1 expressed in: E.coli

Mouse Dispatched Homolog 1 (DISP1) Protein

20-abx066351
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

DISP1 sgRNA CRISPR Lentivector set (Human)

K0604701 3 x 1.0 ug
EUR 339

Disp1 sgRNA CRISPR Lentivector set (Rat)

K6452601 3 x 1.0 ug
EUR 339

Disp1 sgRNA CRISPR Lentivector set (Mouse)

K3768101 3 x 1.0 ug
EUR 339

DISP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0604702 1.0 ug DNA
EUR 154

DISP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0604703 1.0 ug DNA
EUR 154

DISP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0604704 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6452602 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6452603 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6452604 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3768102 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3768103 1.0 ug DNA
EUR 154

Disp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3768104 1.0 ug DNA
EUR 154

DISP1 Protein Vector (Mouse) (pPB-C-His)

PV172158 500 ng
EUR 2570

DISP1 Protein Vector (Mouse) (pPB-N-His)

PV172159 500 ng
EUR 2570

DISP1 Protein Vector (Mouse) (pPM-C-HA)

PV172160 500 ng
EUR 2570

DISP1 Protein Vector (Mouse) (pPM-C-His)

PV172161 500 ng
EUR 2570

DISP1 Protein Vector (Rat) (pPB-C-His)

PV264134 500 ng
EUR 2571

DISP1 Protein Vector (Rat) (pPB-N-His)

PV264135 500 ng
EUR 2571

DISP1 Protein Vector (Rat) (pPM-C-HA)

PV264136 500 ng
EUR 2571

DISP1 Protein Vector (Rat) (pPM-C-His)

PV264137 500 ng
EUR 2571

DISP1 Protein Vector (Human) (pPB-C-His)

PV012505 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPB-N-His)

PV012506 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPM-C-HA)

PV012507 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPM-C-His)

PV012508 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPB-C-His)

PV012509 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPB-N-His)

PV012510 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPM-C-HA)

PV012511 500 ng
EUR 329

DISP1 Protein Vector (Human) (pPM-C-His)

PV012512 500 ng
EUR 329

Disp1 3'UTR GFP Stable Cell Line

TU155165 1.0 ml Ask for price

Disp1 3'UTR Luciferase Stable Cell Line

TU105165 1.0 ml Ask for price

Disp1 3'UTR Luciferase Stable Cell Line

TU203429 1.0 ml Ask for price

Disp1 3'UTR GFP Stable Cell Line

TU253429 1.0 ml Ask for price

DISP1 3'UTR GFP Stable Cell Line

TU056037 1.0 ml
EUR 1394

DISP1 3'UTR Luciferase Stable Cell Line

TU006037 1.0 ml
EUR 1394

Mouse Protein dispatched homolog 1, Disp1 ELISA KIT

ELI-26868m 96 Tests
EUR 865

Human Protein dispatched homolog 1 (DISP1) ELISA Kit

abx386894-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein dispatched homolog 1 (DISP1) ELISA Kit

abx389081-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

DISP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709323 1.0 ug DNA
EUR 316

DISP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709327 1.0 ug DNA
EUR 316

DISP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709328 1.0 ug DNA
EUR 316

Human Protein dispatched homolog 1, DISP1 ELISA KIT

ELI-31941h 96 Tests
EUR 824

DISP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV653173 1.0 ug DNA
EUR 2402

DISP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV653177 1.0 ug DNA
EUR 2402

DISP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV653178 1.0 ug DNA
EUR 2402

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

DISP1 Rabbit Polyclonal Antibody