ECE1 Rabbit Polyclonal Antibody
ECE1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
ECE1 Polyclonal Antibody |
ABP58449-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ECE1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ECE1 from Human, Mouse, Rat. This ECE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ECE1 protein |
ECE1 Polyclonal Antibody |
ABP58449-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ECE1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ECE1 from Human, Mouse, Rat. This ECE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ECE1 protein |
ECE1 Polyclonal Antibody |
ES11105-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ECE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ECE1 Polyclonal Antibody |
ES11105-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ECE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ECE1 Rabbit pAb |
A5638-100ul |
Abclonal |
100 ul |
EUR 308 |
ECE1 Rabbit pAb |
A5638-200ul |
Abclonal |
200 ul |
EUR 459 |
ECE1 Rabbit pAb |
A5638-20ul |
Abclonal |
20 ul |
EUR 183 |
ECE1 Rabbit pAb |
A5638-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit |
DLR-ECE1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelin Converting Enzyme 1 (ECE1) in samples from serum, plasma or other biological fluids. |
Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit |
DLR-ECE1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelin Converting Enzyme 1 (ECE1) in samples from serum, plasma or other biological fluids. |
Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit |
RDR-ECE1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit |
RDR-ECE1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit |
RD-ECE1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit |
RD-ECE1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Polyclonal ECE1 Antibody (Center) |
APR07638G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ECE1 (Center). This antibody is tested and proven to work in the following applications: |
ECE1 Antibody |
32939-100ul |
SAB |
100ul |
EUR 252 |
ECE1 Antibody |
1-CSB-PA105007 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ECE1. Recognizes ECE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
ECE1 Antibody |
1-CSB-PA891748 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ECE1. Recognizes ECE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:1000-1:5000 |
ECE1 Antibody |
DF7430 |
Affbiotech |
200ul |
EUR 304 |
Description: ECE1 Antibody detects endogenous levels of total ECE1. |
ECE1 Antibody |
1-CSB-PA007371ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ECE1. Recognizes ECE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Anti-ECE1 Antibody |
A02519-1 |
BosterBio |
100ug/vial |
EUR 294 |
ECE1 Conjugated Antibody |
C32939 |
SAB |
100ul |
EUR 397 |
Anti-ECE1 antibody |
STJ27605 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. |
Anti-ECE1 antibody |
STJ192263 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ECE1 |
ECE1 siRNA |
20-abx914901 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ECE1 siRNA |
20-abx914902 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ECE1 |
YF-PA11475 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ECE1 |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human) |
4-PAA483Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Leu469~Glu721)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1) |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse) |
4-PAA483Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Ala326~Asn577)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1) |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat) |
4-PAA483Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (His214~Ala448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1) |
ECE1 Blocking Peptide |
DF7430-BP |
Affbiotech |
1mg |
EUR 195 |
ECE1 cloning plasmid |
CSB-CL007371HU-10ug |
Cusabio |
10ug |
EUR 758 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2313
- Sequence: atgcggggcgtgtggccgcccccggtgtccgccctgctgtcggcgctggggatgtcgacgtacaagcgggccacgctggacgaggaggacctggtggactcgctctccgagggcgacgcataccccaacggcctgcaggtgaacttccacagcccccggagtggccagaggtgct
- Show more
|
Description: A cloning plasmid for the ECE1 gene. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), APC |
4-PAA483Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Leu469~Glu721)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), Biotinylated |
4-PAA483Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Leu469~Glu721)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), Cy3 |
4-PAA483Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Leu469~Glu721)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), FITC |
4-PAA483Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Leu469~Glu721)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), HRP |
4-PAA483Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Leu469~Glu721)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), PE |
4-PAA483Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Leu469~Glu721)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), APC |
4-PAA483Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Ala326~Asn577)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA483Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Ala326~Asn577)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), Cy3 |
4-PAA483Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Ala326~Asn577)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), FITC |
4-PAA483Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Ala326~Asn577)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), HRP |
4-PAA483Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Ala326~Asn577)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), PE |
4-PAA483Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Ala326~Asn577)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), APC |
4-PAA483Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (His214~Ala448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), Biotinylated |
4-PAA483Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (His214~Ala448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), Cy3 |
4-PAA483Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (His214~Ala448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), FITC |
4-PAA483Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (His214~Ala448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), HRP |
4-PAA483Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (His214~Ala448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), PE |
4-PAA483Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (His214~Ala448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE. |
Rabbit Endothelin Converting Enzyme 1 (ECE1) ELISA Kit |
abx362668-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
20-abx004310 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
20-abx214580 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
20-abx214643 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
20-abx103137 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
20-abx103138 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
20-abx130012 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
abx145201-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
20-abx172239 |
Abbexa |
|
|
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
abx033018-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
abx033018-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
abx033019-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
abx033019-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
abx033020-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
abx033020-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Antibody |
20-abx320177 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA483Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Leu469~Glu721)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAA483Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (Ala326~Asn577)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7. |
Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA483Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ECE1 (His214~Ala448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7. |
Mouse ECE1 shRNA Plasmid |
20-abx981830 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ECE1 shRNA Plasmid |
20-abx951315 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ECE1 Recombinant Protein (Human) |
RP038692 |
ABM |
100 ug |
Ask for price |
ECE1 Recombinant Protein (Rat) |
RP198998 |
ABM |
100 ug |
Ask for price |
ECE1 Recombinant Protein (Mouse) |
RP130712 |
ABM |
100 ug |
Ask for price |
Human CellExp? ECE1, Human Recombinant |
P1227-10 |
Biovision |
|
EUR 251 |
Human CellExp? ECE1, Human Recombinant |
P1227-50 |
Biovision |
|
EUR 1012 |
Ece1 ORF Vector (Rat) (pORF) |
ORF066334 |
ABM |
1.0 ug DNA |
EUR 506 |
ECE1 ORF Vector (Human) (pORF) |
ORF012898 |
ABM |
1.0 ug DNA |
EUR 354 |
Ece1 ORF Vector (Mouse) (pORF) |
ORF043572 |
ABM |
1.0 ug DNA |
EUR 506 |
ECE1 ELISA Kit (Human) (OKAN06233) |
OKAN06233 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.8 pg/mL |
ECE1 ELISA Kit (Mouse) (OKCA02377) |
OKCA02377 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Converts big endothelin-1 to endothelin-1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.039 ng/mL |
ECE1 ELISA Kit (Human) (OKCD06380) |
OKCD06380 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 11.8pg/mL |
ECE1 ELISA Kit (Human) (OKEH01929) |
OKEH01929 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 20 pg/mL |
ECE1 sgRNA CRISPR Lentivector set (Human) |
K0651101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ece1 sgRNA CRISPR Lentivector set (Rat) |
K7040501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ece1 sgRNA CRISPR Lentivector set (Mouse) |
K3662701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Endothelin Converting Enzyme 1 (ECE1) |
4-RPA483Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P42892
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Endothelin Converting Enzyme 1 expressed in: E.coli |
Recombinant Endothelin Converting Enzyme 1 (ECE1) |
4-RPA483Mu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q4PZA2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.3kDa
- Isoelectric Point: 6.2
|
Description: Recombinant Mouse Endothelin Converting Enzyme 1 expressed in: E.coli |
Recombinant Endothelin Converting Enzyme 1 (ECE1) |
4-RPA483Ra01 |
Cloud-Clone |
-
EUR 521.12
-
EUR 242.00
-
EUR 1679.20
-
EUR 626.40
-
EUR 1152.80
-
EUR 412.00
-
EUR 4048.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P42893
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.8kDa
- Isoelectric Point: 6
|
Description: Recombinant Rat Endothelin Converting Enzyme 1 expressed in: E.coli |
Rat Endothelin Converting Enzyme 1 (ECE1) Protein |
20-abx168533 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2263.00
-
EUR 871.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Endothelin Converting Enzyme 1 (ECE1) Protein |
20-abx066416 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Endothelin Converting Enzyme 1 (ECE1) Protein |
20-abx066417 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
ECE1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0651102 |
ABM |
1.0 ug DNA |
EUR 154 |
ECE1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0651103 |
ABM |
1.0 ug DNA |
EUR 154 |
ECE1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0651104 |
ABM |
1.0 ug DNA |
EUR 154 |
Ece1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7040502 |
ABM |
1.0 ug DNA |
EUR 154 |
Ece1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7040503 |
ABM |
1.0 ug DNA |
EUR 154 |
Ece1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7040504 |
ABM |
1.0 ug DNA |
EUR 154 |
Ece1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3662702 |
ABM |
1.0 ug DNA |
EUR 154 |
Ece1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3662703 |
ABM |
1.0 ug DNA |
EUR 154 |
Ece1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3662704 |
ABM |
1.0 ug DNA |
EUR 154 |
ECE1 Protein Vector (Mouse) (pPB-C-His) |
PV174286 |
ABM |
500 ng |
EUR 1065 |
ECE1 Protein Vector (Mouse) (pPB-N-His) |
PV174287 |
ABM |
500 ng |
EUR 1065 |
ECE1 Protein Vector (Mouse) (pPM-C-HA) |
PV174288 |
ABM |
500 ng |
EUR 1065 |
ECE1 Protein Vector (Mouse) (pPM-C-His) |
PV174289 |
ABM |
500 ng |
EUR 1065 |
ECE1 Protein Vector (Rat) (pPB-C-His) |
PV265334 |
ABM |
500 ng |
EUR 1166 |
ECE1 Protein Vector (Rat) (pPB-N-His) |
PV265335 |
ABM |
500 ng |
EUR 1166 |
ECE1 Protein Vector (Rat) (pPM-C-HA) |
PV265336 |
ABM |
500 ng |
EUR 1166 |
ECE1 Protein Vector (Rat) (pPM-C-His) |
PV265337 |
ABM |
500 ng |
EUR 1166 |
ECE1 Protein Vector (Human) (pPB-C-His) |
PV051589 |
ABM |
500 ng |
EUR 481 |
ECE1 Protein Vector (Human) (pPB-N-His) |
PV051590 |
ABM |
500 ng |
EUR 481 |
ECE1 Protein Vector (Human) (pPM-C-HA) |
PV051591 |
ABM |
500 ng |
EUR 481 |
ECE1 Protein Vector (Human) (pPM-C-His) |
PV051592 |
ABM |
500 ng |
EUR 481 |
Ece1 3'UTR GFP Stable Cell Line |
TU155573 |
ABM |
1.0 ml |
Ask for price |
Ece1 3'UTR Luciferase Stable Cell Line |
TU105573 |
ABM |
1.0 ml |
Ask for price |
Ece1 3'UTR Luciferase Stable Cell Line |
TU203756 |
ABM |
1.0 ml |
Ask for price |
Ece1 3'UTR GFP Stable Cell Line |
TU253756 |
ABM |
1.0 ml |
Ask for price |
ECE1 3'UTR GFP Stable Cell Line |
TU056532 |
ABM |
1.0 ml |
EUR 1521 |
ECE1 3'UTR Luciferase Stable Cell Line |
TU006532 |
ABM |
1.0 ml |
EUR 1521 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
ECE1 Rabbit Polyclonal Antibody