SKAP1 Rabbit Polyclonal Antibody
SKAP1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
SKAP1 Polyclonal Antibody |
ABP60416-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SKAP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SKAP1 from Human, Mouse, Rat. This SKAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SKAP1 protein |
SKAP1 Polyclonal Antibody |
ABP60416-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SKAP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SKAP1 from Human, Mouse, Rat. This SKAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SKAP1 protein |
SKAP1 Polyclonal Antibody |
ABP60416-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SKAP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SKAP1 from Human, Mouse, Rat. This SKAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SKAP1 protein |
SKAP1 Polyclonal Antibody |
A54280 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
SKAP1 Polyclonal Antibody |
30445-100ul |
SAB |
100ul |
EUR 252 |
SKAP1 Polyclonal Antibody |
30445-50ul |
SAB |
50ul |
EUR 187 |
SKAP1 Rabbit pAb |
A3345-100ul |
Abclonal |
100 ul |
EUR 308 |
SKAP1 Rabbit pAb |
A3345-200ul |
Abclonal |
200 ul |
EUR 459 |
SKAP1 Rabbit pAb |
A3345-20ul |
Abclonal |
20 ul |
EUR 183 |
SKAP1 Rabbit pAb |
A3345-50ul |
Abclonal |
50 ul |
EUR 223 |
SKAP1 Polyclonal Conjugated Antibody |
C30445 |
SAB |
100ul |
EUR 397 |
SKAP1 antibody |
70R-5761 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SKAP1 antibody raised against the N terminal of SKAP1 |
SKAP1 antibody |
70R-21696 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SKAP1 antibody |
SKAP1 Antibody |
1-CSB-PA769799LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
SKAP1 Antibody |
1-CSB-PA021354GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
SKAP1 Polyclonal Antibody, Biotin Conjugated |
A54277 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
SKAP1 Polyclonal Antibody, FITC Conjugated |
A54278 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
SKAP1 Polyclonal Antibody, HRP Conjugated |
A54279 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Anti-SKAP1 antibody |
STJ116201 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a T cell adaptor protein, a class of intracellular molecules with modular domains capable of recruiting additional proteins but that exhibit no intrinsic enzymatic activity. The encoded protein contains a unique N-terminal region followed by a PH domain and C-terminal SH3 domain. Along with the adhesion and degranulation-promoting adaptor protein, the encoded protein plays a critical role in inside-out signaling by coupling T-cell antigen receptor stimulation to the activation of integrins. |
Anti-SKAP1 antibody |
STJ192105 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SKAP1 |
SKAP1 siRNA |
20-abx904950 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SKAP1 siRNA |
20-abx933439 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SKAP1 siRNA |
20-abx933440 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SKAP1 Antibody, HRP conjugated |
1-CSB-PA769799LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SKAP1 Antibody, FITC conjugated |
1-CSB-PA769799LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SKAP1 Antibody, Biotin conjugated |
1-CSB-PA769799LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-SKAP55/SKAP1 Antibody |
PB9890 |
BosterBio |
100ug/vial |
EUR 334 |
SKAP1 Blocking Peptide |
33R-7848 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SKAP1 antibody, catalog no. 70R-5761 |
SKAP1 cloning plasmid |
CSB-CL769799HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1077
- Sequence: atgcaggccgccgccctccctgaggagatccgttggctcctggaagatgctgaagagtttctggcagaaggtttgcggaatgagaacctcagcgctgttgcaagggatcacagagaccatattctacggggctttcagcaaatcaaagccaggtactattgggattttcagcccc
- Show more
|
Description: A cloning plasmid for the SKAP1 gene. |
SKAP1 Rabbit Polyclonal Antibody