REEP1 Rabbit Polyclonal Antibody
REEP1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
REEP1 Polyclonal Antibody |
ABP60123-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
- Applications tips:
|
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110 |
REEP1 Polyclonal Antibody |
ABP60123-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
- Applications tips:
|
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110 |
REEP1 Polyclonal Antibody |
ABP60123-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
- Applications tips:
|
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110 |
REEP1 Polyclonal Antibody |
31353-100ul |
SAB |
100ul |
EUR 252 |
REEP1 Polyclonal Antibody |
31353-50ul |
SAB |
50ul |
EUR 187 |
REEP1 Rabbit pAb |
A7832-100ul |
Abclonal |
100 ul |
EUR 308 |
REEP1 Rabbit pAb |
A7832-200ul |
Abclonal |
200 ul |
EUR 459 |
REEP1 Rabbit pAb |
A7832-20ul |
Abclonal |
20 ul |
EUR 183 |
REEP1 Rabbit pAb |
A7832-50ul |
Abclonal |
50 ul |
EUR 223 |
REEP1 Polyclonal Conjugated Antibody |
C31353 |
SAB |
100ul |
EUR 397 |
REEP1 antibody |
70R-7241 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal REEP1 antibody raised against the middle region of REEP1 |
REEP1 antibody |
70R-7467 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal REEP1 antibody raised against the C terminal of REEP1 |
REEP1 antibody |
70R-19848 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal REEP1 antibody |
REEP1 Antibody |
DF12719 |
Affbiotech |
200ul |
EUR 304 |
Description: REEP1 Antibody detects endogenous levels of REEP1. |
REEP1 Antibody |
1-CSB-PA862045DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
REEP1 Antibody |
1-CSB-PA862045DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
REEP1 Antibody |
1-CSB-PA019540GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
anti- REEP1 antibody |
FNab07229 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: receptor accessory protein 1
- Uniprot ID: Q9H902
- Gene ID: 65055
- Research Area: Metabolism
|
Description: Antibody raised against REEP1 |
Anti-REEP1 antibody |
STJ110142 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. |
Anti-REEP1 antibody |
STJ192598 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to REEP1 |
REEP1 siRNA |
20-abx931216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
REEP1 siRNA |
20-abx931217 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal antibody for REEP1 |
SMC-480D |
Stressmarq |
0.1mg |
EUR 353 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated. |
Monoclonal antibody for REEP1 |
SMC-480D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 390. |
Monoclonal antibody for REEP1 |
SMC-480D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 488. |
Monoclonal antibody for REEP1 |
SMC-480D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 565. |
Monoclonal antibody for REEP1 |
SMC-480D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 594. |
Monoclonal antibody for REEP1 |
SMC-480D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 633. |
Monoclonal antibody for REEP1 |
SMC-480D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 655. |
Monoclonal antibody for REEP1 |
SMC-480D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 680. |
Monoclonal antibody for REEP1 |
SMC-480D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 700. |
Monoclonal antibody for REEP1 |
SMC-480D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for REEP1 |
SMC-480D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC. |
Monoclonal antibody for REEP1 |
SMC-480D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC/Cy7. |
Monoclonal antibody for REEP1 |
SMC-480D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Biotin. |
Monoclonal antibody for REEP1 |
SMC-480D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 350. |
Monoclonal antibody for REEP1 |
SMC-480D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 405. |
Monoclonal antibody for REEP1 |
SMC-480D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 488. |
Monoclonal antibody for REEP1 |
SMC-480D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 594. |
Monoclonal antibody for REEP1 |
SMC-480D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 633. |
Monoclonal antibody for REEP1 |
SMC-480D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with FITC. |
Monoclonal antibody for REEP1 |
SMC-480D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with HRP. |
Monoclonal antibody for REEP1 |
SMC-480D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PE/ATTO 594. |
Monoclonal antibody for REEP1 |
SMC-480D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PerCP. |
Monoclonal antibody for REEP1 |
SMC-480D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with RPE. |
Monoclonal antibody for REEP1 |
SMC-480D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Streptavidin. |
Monoclonal antibody for REEP1 |
SMC-480S |
Stressmarq |
0.012mg |
EUR 65 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated. |
REEP1 Blocking Peptide |
33R-1288 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADCYAP1R1 antibody, catalog no. 70R-9939 |
REEP1 Blocking Peptide |
33R-2704 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REEP1 antibody, catalog no. 70R-7467 |
REEP1 cloning plasmid |
CSB-CL862045HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 606
- Sequence: atggtgtcatggatcatctccaggctggtggtgcttatatttggcaccctttaccctgcgtattattcctacaaggctgtgaaatcaaaggacattaaggaatatgtcaaatggatgatgtactggattatatttgcacttttcaccacagcagagacattcacagacatcttcct
- Show more
|
Description: A cloning plasmid for the REEP1 gene. |
REEP1 Blocking Peptide |
DF12719-BP |
Affbiotech |
1mg |
EUR 195 |
Monoclonal antibody for REEP1/2 |
SMC-482D |
Stressmarq |
0.1mg |
EUR 353 |
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated. |
Monoclonal antibody for REEP1/2 |
SMC-482D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 390. |
Monoclonal antibody for REEP1/2 |
SMC-482D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 488. |
REEP1 Rabbit Polyclonal Antibody