FGGY Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FGGY Polyclonal Antibody
28752-50ul	SAB	50ul	EUR 187

FGGY Polyclonal Antibody
ABP58552-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540 Applications tips:
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540

FGGY Polyclonal Antibody
ABP58552-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540 Applications tips:
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540

FGGY Polyclonal Antibody
ABP58552-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540 Applications tips:
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540

FGGY Polyclonal Antibody
ES11426-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGGY Polyclonal Antibody
ES11426-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGGY Rabbit pAb
A14904-100ul	Abclonal	100 ul	EUR 308

FGGY Rabbit pAb
A14904-200ul	Abclonal	200 ul	EUR 459

FGGY Rabbit pAb
A14904-20ul	Abclonal	20 ul	EUR 183

FGGY Rabbit pAb
A14904-50ul	Abclonal	50 ul	EUR 223

FGGY Polyclonal Conjugated Antibody
C28752	SAB	100ul	EUR 397

Fggy antibody
70R-8778	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Fggy antibody

Polyclonal Fggy antibody - N-terminal region
APR11909G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fggy - N-terminal region. This antibody is tested and proven to work in the following applications:

Anti-FGGY antibody
STJ117104	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants.

Anti-FGGY antibody
STJ192584	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FGGY

FGGY siRNA
20-abx916860	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FGGY siRNA
20-abx916861	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-FGGY
PVT18905	Lifescience Market	2 ug	EUR 231

Fggy Blocking Peptide
33R-6678	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fggy antibody, catalog no. 70R-8778

FGGY cloning plasmid
CSB-CL853393HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1320 Sequence: atgtggctggaccatcgagcagtcagtcaagttaacaggatcaatgagaccaagcacagtgtcctccagtacgtcgggggggtgatgtctgtggaaatgcaggccccgaaacttctgtggctgaaagagaacttgagagagatttgctgggataaggcgggacatttctttgatc Show more
Description: A cloning plasmid for the FGGY gene.

FGGY cloning plasmid
CSB-CL853393HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 759 Sequence: atggggatcagcaaagacccgatttttgtaccaggcgtctgggggccttatttctcagccatggtacctgggttctggctgaatgaaggtggtcagagcgttactggaaaattgatagaccacatggtacaaggccatgctgcttttccagaactacaagtaaaggccacagccag Show more
Description: A cloning plasmid for the FGGY gene.

Human FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit
abx384900-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit
abx389281-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Fggy ELISA KIT
ELI-26682m	Lifescience Market	96 Tests	EUR 865

FGGY ELISA KIT|Human
EF004978	Lifescience Market	96 Tests	EUR 689

Mouse FGGY shRNA Plasmid
20-abx978434	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FGGY shRNA Plasmid
20-abx960616	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FGGY ELISA KIT
ELI-47438h	Lifescience Market	96 Tests	EUR 824

FGGY Recombinant Protein (Human)
RP012145	ABM	100 ug	Ask for price

FGGY Recombinant Protein (Human)
RP012148	ABM	100 ug	Ask for price

FGGY Recombinant Protein (Rat)
RP201371	ABM	100 ug	Ask for price

FGGY Recombinant Protein (Mouse)
RP134561	ABM	100 ug	Ask for price

FGGY Recombinant Protein (Mouse)
RP134564	ABM	100 ug	Ask for price

Fggy ORF Vector (Rat) (pORF)
ORF067125	ABM	1.0 ug DNA	EUR 506

FGGY ORF Vector (Human) (pORF)
ORF004049	ABM	1.0 ug DNA	EUR 95

FGGY ORF Vector (Human) (pORF)
ORF004050	ABM	1.0 ug DNA	EUR 95

Fggy ORF Vector (Mouse) (pORF)
ORF044855	ABM	1.0 ug DNA	EUR 506

Fggy ORF Vector (Mouse) (pORF)
ORF044856	ABM	1.0 ug DNA	EUR 506

Fggy sgRNA CRISPR Lentivector set (Rat)
K7423001	ABM	3 x 1.0 ug	EUR 339

FGGY sgRNA CRISPR Lentivector set (Human)
K0780701	ABM	3 x 1.0 ug	EUR 339

Fggy sgRNA CRISPR Lentivector set (Mouse)
K4105601	ABM	3 x 1.0 ug	EUR 339

FGGY Rabbit Polyclonal Antibody