AOC3 Rabbit Polyclonal Antibody
AOC3 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
AOC3 Polyclonal Antibody |
ES11338-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against AOC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AOC3 Rabbit pAb |
A2001-100ul |
Abclonal |
100 ul |
EUR 308 |
AOC3 Rabbit pAb |
A2001-200ul |
Abclonal |
200 ul |
EUR 459 |
AOC3 Rabbit pAb |
A2001-20ul |
Abclonal |
20 ul |
EUR 183 |
AOC3 Rabbit pAb |
A2001-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal AOC3 Antibody (Center) |
APR11425G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AOC3 (Center). This antibody is tested and proven to work in the following applications: |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
AOC3 antibody |
70R-15743 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal AOC3 antibody |
AOC3 Antibody |
32546-100ul |
SAB |
100ul |
EUR 252 |
AOC3 Antibody |
43880-100ul |
SAB |
100ul |
EUR 252 |
AOC3 Antibody |
1-CSB-PA001855GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
AOC3 Antibody |
1-CSB-PA624122LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
AOC3 Antibody |
DF6745 |
Affbiotech |
200ul |
EUR 304 |
Description: AOC3 Antibody detects endogenous levels of total AOC3. |
Polyclonal Goat Anti-AOC3 Antibody |
APR12069G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AOC3 . This antibody is tested and proven to work in the following applications: |
Polyclonal AOC3 / VAP-1 Antibody (Internal) |
AMRa00049G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AOC3 / VAP-1 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal AOC3 / VAP1 Antibody (internal region) |
APR11424G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AOC3 / VAP1 (internal region). This antibody is tested and proven to work in the following applications: |
AOC3 Conjugated Antibody |
C43880 |
SAB |
100ul |
EUR 397 |
AOC3 Conjugated Antibody |
C32546 |
SAB |
100ul |
EUR 397 |
Anti-AOC3 antibody |
STJ22624 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. |
Anti-AOC3 antibody |
STJ192496 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AOC3 |
AOC3 siRNA |
20-abx900345 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AOC3 siRNA |
20-abx907688 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AOC3 siRNA |
20-abx907689 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AOC3 Antibody, HRP conjugated |
1-CSB-PA624122LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
AOC3 Antibody, FITC conjugated |
1-CSB-PA624122LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
AOC3 Antibody, Biotin conjugated |
1-CSB-PA624122LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
AOC3 Blocking Peptide |
DF6745-BP |
Affbiotech |
1mg |
EUR 195 |
AOC3 cloning plasmid |
CSB-CL624122HU-10ug |
Cusabio |
10ug |
EUR 751 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2292
- Sequence: atgaaccagaagacaatcctcgtgctcctcattctggccgtcatcaccatctttgccttggtttgtgtcctgctggtgggcaggggtggagatgggggtgaacccagccagcttccccattgcccctctgtatctcccagtgcccagccttggacacaccctggccagagccagc
- Show more
|
Description: A cloning plasmid for the AOC3 gene. |
Membrane Primary Amine Oxidase (AOC3) Antibody |
20-abx110946 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody |
abx033988-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody |
abx033988-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody |
20-abx333876 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody |
20-abx001627 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rat AOC3 shRNA Plasmid |
20-abx985523 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human AOC3 shRNA Plasmid |
20-abx955678 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse AOC3 shRNA Plasmid |
20-abx969153 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
AOC3 Recombinant Protein (Human) |
RP001399 |
ABM |
100 ug |
Ask for price |
AOC3 Recombinant Protein (Mouse) |
RP116186 |
ABM |
100 ug |
Ask for price |
AOC3 Recombinant Protein (Rat) |
RP190385 |
ABM |
100 ug |
Ask for price |
Amine Oxidase, Copper Containing 3 (AOC3) Antibody |
20-abx175354 |
Abbexa |
|
|
|
Amine Oxidase, Copper Containing 3 (AOC3) Antibody |
20-abx175355 |
Abbexa |
|
|
|
Membrane Primary Amine Oxidase (AOC3) Antibody (HRP) |
20-abx336489 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody (FITC) |
20-abx336490 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody (Biotin) |
20-abx336491 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Amine Oxidase, Copper Containing 3 (AOC3) Antibody |
abx430190-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Amine Oxidase, Copper Containing 3 (AOC3) Antibody |
abx431095-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Aoc3 ORF Vector (Rat) (pORF) |
ORF063463 |
ABM |
1.0 ug DNA |
EUR 506 |
AOC3 ORF Vector (Human) (pORF) |
ORF000467 |
ABM |
1.0 ug DNA |
EUR 95 |
Aoc3 ORF Vector (Mouse) (pORF) |
ORF038730 |
ABM |
1.0 ug DNA |
EUR 506 |
AOC3 ELISA Kit (Mouse) (OKAN05141) |
OKAN05141 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.65 ng/mL |
AOC3 ELISA Kit (Human) (OKBB01153) |
OKBB01153 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Amine oxidase, copper containing 3, also known as vascular adhesion protein (VAP-1) and HPAO is an enzyme that in humans is encoded by the AOC3 gene on chromosome 17. This protein is a member of the semicarbazide-sensitive amine oxidase (SSAO) family and is associated with many vascular diseases. This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <20pg/ml |
AOC3 ELISA Kit (Mouse) (OKCD08074) |
OKCD08074 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: Cell adhesion protein that participates in lymphocyte recirculation by mediating the binding of lymphocytes to peripheral lymph node vascular endothelial cells in an L-selectin-independent fashion. Has a monoamine oxidase activity. May play a role in adipogenesis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.65ng/mL |
AOC3 ELISA Kit (Mouse) (OKEH03283) |
OKEH03283 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Cell adhesion protein that participates in lymphocyte recirculation by mediating the binding of lymphocytes to peripheral lymph node vascular endothelial cells in an L-selectin-independent fashion. Has a monoamine oxidase activity. May play a role in adipogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL |
AOC3 ELISA Kit (Rat) (OKEH03284) |
OKEH03284 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Cell adhesion protein that participates in lymphocyte recirculation by mediating the binding of lymphocytes to peripheral lymph node vascular endothelial cells in an L-selectin-independent fashion. Has a monoamine oxidase activity. May play a role in adipogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.402 ng/mL |
Anti-AOC3 (Vapaliximab)-SPDB-DM4 ADC |
ADC-W-669 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a SPDB linker to DM4 |
Anti-AOC3 (Vapaliximab)-MC-MMAF ADC |
ADC-W-670 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a MC linker to MMAF |
Anti-AOC3 (Vepalimomab)-SMCC-DM1 ADC |
ADC-W-674 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a SMCC linker to DM1 |
Anti-AOC3 (Vepalimomab)-SPDB-DM4 ADC |
ADC-W-675 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a SPDB linker to DM4 |
Anti-AOC3 (Vepalimomab)-MC-MMAF ADC |
ADC-W-676 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a MC linker to MMAF |
Aoc3 sgRNA CRISPR Lentivector set (Rat) |
K6774801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Aoc3 sgRNA CRISPR Lentivector set (Mouse) |
K4574201 |
ABM |
3 x 1.0 ug |
EUR 339 |
AOC3 sgRNA CRISPR Lentivector set (Human) |
K0099001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human VAP-1/AOC3 PicoKine ELISA Kit |
EK1646 |
BosterBio |
96 wells |
EUR 425 |
Description: For Quantitative Detection of human VAP-1 in cell culture supernates, serum and plasma (heparin, EDTA). |
Anti-AOC3 (Vapaliximab) (Vapaliximab)-SMCC-DM1 ADC |
ADC-W-668 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-AOC3 monoclonal antibody conjugated via a SMCC linker to DM1 |
Aoc3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6774802 |
ABM |
1.0 ug DNA |
EUR 154 |
Aoc3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6774803 |
ABM |
1.0 ug DNA |
EUR 154 |
Aoc3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6774804 |
ABM |
1.0 ug DNA |
EUR 154 |
Aoc3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4574202 |
ABM |
1.0 ug DNA |
EUR 154 |
Aoc3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4574203 |
ABM |
1.0 ug DNA |
EUR 154 |
Aoc3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4574204 |
ABM |
1.0 ug DNA |
EUR 154 |
AOC3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0099002 |
ABM |
1.0 ug DNA |
EUR 154 |
AOC3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0099003 |
ABM |
1.0 ug DNA |
EUR 154 |
AOC3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0099004 |
ABM |
1.0 ug DNA |
EUR 154 |
AOC3 Protein Vector (Mouse) (pPB-C-His) |
PV154918 |
ABM |
500 ng |
EUR 1065 |
AOC3 Protein Vector (Mouse) (pPB-N-His) |
PV154919 |
ABM |
500 ng |
EUR 1065 |
AOC3 Protein Vector (Mouse) (pPM-C-HA) |
PV154920 |
ABM |
500 ng |
EUR 1065 |
AOC3 Protein Vector (Mouse) (pPM-C-His) |
PV154921 |
ABM |
500 ng |
EUR 1065 |
AOC3 Protein Vector (Rat) (pPB-C-His) |
PV253850 |
ABM |
500 ng |
EUR 1166 |
AOC3 Protein Vector (Rat) (pPB-N-His) |
PV253851 |
ABM |
500 ng |
EUR 1166 |
AOC3 Protein Vector (Rat) (pPM-C-HA) |
PV253852 |
ABM |
500 ng |
EUR 1166 |
AOC3 Protein Vector (Rat) (pPM-C-His) |
PV253853 |
ABM |
500 ng |
EUR 1166 |
AOC3 Protein Vector (Human) (pPB-His-MBP) |
PV322478 |
ABM |
500 ng |
EUR 329 |
AOC3 Protein Vector (Human) (pPB-His-GST) |
PV322479 |
ABM |
500 ng |
EUR 329 |
AOC3 Protein Vector (Human) (pPB-C-His) |
PV001865 |
ABM |
500 ng |
EUR 329 |
AOC3 Protein Vector (Human) (pPB-N-His) |
PV001866 |
ABM |
500 ng |
EUR 329 |
AOC3 Protein Vector (Human) (pPM-C-HA) |
PV001867 |
ABM |
500 ng |
EUR 329 |
AOC3 Protein Vector (Human) (pPM-C-His) |
PV001868 |
ABM |
500 ng |
EUR 329 |
Aoc3 3'UTR GFP Stable Cell Line |
TU151895 |
ABM |
1.0 ml |
Ask for price |
Aoc3 3'UTR Luciferase Stable Cell Line |
TU101895 |
ABM |
1.0 ml |
Ask for price |
Aoc3 3'UTR Luciferase Stable Cell Line |
TU200705 |
ABM |
1.0 ml |
Ask for price |
Aoc3 3'UTR GFP Stable Cell Line |
TU250705 |
ABM |
1.0 ml |
Ask for price |
AOC3 3'UTR GFP Stable Cell Line |
TU050896 |
ABM |
1.0 ml |
EUR 1521 |
AOC3 3'UTR Luciferase Stable Cell Line |
TU000896 |
ABM |
1.0 ml |
EUR 1521 |
AOC3 ELISA Kit (Human) : 96 Wells (OKEH00749) |
OKEH00749 |
Aviva Systems Biology |
96 Wells |
EUR 544 |
Description: Description of target: This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
AOC3 Rabbit Polyclonal Antibody