NR1H2 Rabbit Polyclonal Antibody

NR1H2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

NR1H2 Polyclonal Antibody
ES10971-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NR1H2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NR1H2 Polyclonal Antibody
ABP59522-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein
NR1H2 Polyclonal Antibody
ABP59522-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein
NR1H2 Polyclonal Antibody
ABP59522-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein
NR1H2 Polyclonal Antibody
29799-100ul 100ul
EUR 252
NR1H2 Polyclonal Antibody
29799-50ul 50ul
EUR 187
NR1H2 Rabbit pAb
A16291-100ul 100 ul
EUR 308
NR1H2 Rabbit pAb
A16291-200ul 200 ul
EUR 459
NR1H2 Rabbit pAb
A16291-20ul 20 ul
EUR 183
NR1H2 Rabbit pAb
A16291-50ul 50 ul
EUR 223
NR1H2 Rabbit pAb
A8979-100ul 100 ul
EUR 308
NR1H2 Rabbit pAb
A8979-200ul 200 ul
EUR 459
NR1H2 Rabbit pAb
A8979-20ul 20 ul Ask for price
NR1H2 Rabbit pAb
A8979-50ul 50 ul Ask for price
NR1H2 Polyclonal Conjugated Antibody
C29799 100ul
EUR 397
NR1H2 antibody
70R-18948 50 ul
EUR 435
Description: Rabbit polyclonal NR1H2 antibody
NR1H2 antibody
70R-1007 100 ug
EUR 377
Description: Rabbit polyclonal NR1H2 antibody raised against the middle region of NR1H2
NR1H2 Antibody
DF12126 200ul
EUR 304
Description: NR1H2 antibody detects endogenous levels of NR1H2.
NR1H2 Antibody
1-CSB-PA016045GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
NR1H2 Antibody
1-CSB-PA016045HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
Polyclonal NR1H2 Antibody (N-term)
APR08815G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR1H2 (N-term). This antibody is tested and proven to work in the following applications:
anti- NR1H2 antibody
FNab05834 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: nuclear receptor subfamily 1, group H, member 2
  • Uniprot ID: P55055
  • Gene ID: 7376
  • Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against NR1H2
Anti-NR1H2 antibody
PAab05834 100 ug
EUR 386
Anti-NR1H2 antibody
STJ111504 100 µl
EUR 277
Anti-NR1H2 antibody
STJ118737 100 µl
EUR 277
Anti-NR1H2 antibody
STJ192129 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR1H2
NR1H2 siRNA
20-abx903642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NR1H2 siRNA
20-abx926321
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NR1H2 siRNA
20-abx926322
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Polyclonal NR1H2 / LXR Beta Antibody (N-Terminus)
APR08812G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NR1H2 / LXR Beta (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-LXR beta / NR1H2 Antibody
AMM05049G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LXR beta / NR1H2 . This antibody is tested and proven to work in the following applications:
NR1H2 Antibody, HRP conjugated
1-CSB-PA016045HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
NR1H2 Antibody, FITC conjugated
1-CSB-PA016045HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
NR1H2 Antibody, Biotin conjugated
1-CSB-PA016045HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
NR1H2 cloning plasmid
CSB-CL016045HU-10ug 10ug
EUR 497
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1386
  • Sequence: atgtcctctcctaccacgagttccctggatacccccctgcctggaaatggcccccctcagcctggcgccccttcttcttcacccactgtaaaggaggagggtccggagccgtggcccgggggtccggaccctgatgtcccaggcactgatgaggccagctcagcctgcagcacag
  • Show more
Description: A cloning plasmid for the NR1H2 gene.
NR1H2 Blocking Peptide
33R-6119 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR1H2 antibody, catalog no. 70R-1007
NR1H2 Blocking Peptide
DF12126-BP 1mg
EUR 195
pDONR223-NR1H2 Plasmid
PVTB01054-1 2 ug
EUR 356
Anti-LXR beta / NR1H2 antibody
STJ70603 100 µg
EUR 359
Rat NR1H2 shRNA Plasmid
20-abx985915
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human NR1H2 ELISA Kit
ELA-E0212h 96 Tests
EUR 824
NR1H2 ELISA KIT|Human
EF000502 96 Tests
EUR 689
Human NR1H2 shRNA Plasmid
20-abx955046
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse NR1H2 shRNA Plasmid
20-abx973322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NR1H2 Recombinant Protein (Human)
RP021589 100 ug Ask for price
NR1H2 Recombinant Protein (Rat)
RP214439 100 ug Ask for price
NR1H2 Recombinant Protein (Mouse)
RP154847 100 ug Ask for price
Oxysterols Receptor LXR-Beta (NR1H2) Antibody
20-abx123816
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Oxysterols Receptor LXR-Beta (NR1H2) Antibody
abx033981-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Oxysterols Receptor LXR-Beta (NR1H2) Antibody
abx033981-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Oxysterols Receptor LXR-Beta (NR1H2) Antibody
20-abx312965
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Oxysterols Receptor LXR-Beta (NR1H2) Antibody
abx235834-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Monoclonal NR1H2 Antibody (monoclonal) (M04), Clone: 10
APR08814G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NR1H2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 10. This antibody is applicable in WB and IF, E
Oxysterols Receptor LXR-Beta (NR1H2) Antibody (HRP)
20-abx312966
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NR1H2 Rabbit Polyclonal Antibody