ERMAP Rabbit Polyclonal Antibody
ERMAP Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
ERMAP Polyclonal Antibody |
ABP58497-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ERMAP protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of ERMAP from Human, Mouse. This ERMAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ERMAP protein at amino acid sequence of 30-110 |
ERMAP Polyclonal Antibody |
27431-100ul |
SAB |
100ul |
EUR 252 |
ERMAP Polyclonal Antibody |
27431-50ul |
SAB |
50ul |
EUR 187 |
ERMAP Rabbit pAb |
A10425-100ul |
Abclonal |
100 ul |
EUR 308 |
ERMAP Rabbit pAb |
A10425-200ul |
Abclonal |
200 ul |
EUR 459 |
ERMAP Rabbit pAb |
A10425-20ul |
Abclonal |
20 ul |
EUR 183 |
ERMAP Rabbit pAb |
A10425-50ul |
Abclonal |
50 ul |
EUR 223 |
ERMAP Polyclonal Conjugated Antibody |
C31940 |
SAB |
100ul |
EUR 397 |
ERMAP Polyclonal Conjugated Antibody |
C27431 |
SAB |
100ul |
EUR 397 |
ERMAP antibody |
70R-7347 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ERMAP antibody |
ERMAP antibody |
70R-7360 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ERMAP antibody |
ERMAP Antibody |
39845-100ul |
SAB |
100ul |
EUR 390 |
ERMAP antibody |
31940-100ul |
SAB |
100ul |
EUR 252 |
ERMAP antibody |
31940-50ul |
SAB |
50ul |
EUR 187 |
ERMAP antibody |
10R-4029 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal ERMAP antibody |
anti- ERMAP antibody |
FNab02850 |
FN Test |
100µg |
EUR 585 |
- Immunogen: erythroblast membrane-associated protein(Scianna blood group)
- Uniprot ID: Q96PL5
- Gene ID: 114625
- Research Area: Immunology
|
Description: Antibody raised against ERMAP |
Anti-ERMAP antibody |
STJ112457 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. |
Anti-ERMAP antibody |
STJ192371 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ERMAP |
ERMAP siRNA |
20-abx915648 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ERMAP siRNA |
20-abx915649 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ERMAP |
YF-PA21865 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to ERMAP |
anti-ERMAP |
YF-PA21866 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ERMAP |
anti-ERMAP |
YF-PA21867 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to ERMAP |
anti-ERMAP |
YF-PA21868 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to ERMAP |
anti-ERMAP |
YF-PA26813 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to ERMAP |
ERMAP Blocking Peptide |
33R-6968 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERMAP antibody, catalog no. 70R-7360 |
ERMAP Blocking Peptide |
33R-8176 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERMAP antibody, catalog no. 70R-7347 |
ERMAP cloning plasmid |
CSB-CL853480HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1428
- Sequence: ATGGAGATGGCGAGTTCTGCTGGCTCCTGGCTCTCTGGCTGCCTCATCCCTCTCGTCTTCCTCCGGCTGTCTGTGCATGTGTCAGGCCACGCAGGGGATGCCGGCAAGTTCCACGTGGCCCTACTAGGGGGCACAGCCGAGCTGCTCTGCCCTCTCTCCCTCTGGCCCGGGACGG
- Show more
|
Description: A cloning plasmid for the ERMAP gene. |
anti-ERMAP (6F8) |
LF-MA10101 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ERMAP |
Mouse ERMAP shRNA Plasmid |
20-abx973817 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ERMAP shRNA Plasmid |
20-abx964360 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ERMAP Recombinant Protein (Human) |
RP038803 |
ABM |
100 ug |
Ask for price |
ERMAP Recombinant Protein (Mouse) |
RP132197 |
ABM |
100 ug |
Ask for price |
Monoclonal ERMAP Antibody (monoclonal) (M01), Clone: 6F8 |
APR15870G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ERMAP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6F8. This antibody is applicable in WB, E |
Ermap ORF Vector (Mouse) (pORF) |
ORF044067 |
ABM |
1.0 ug DNA |
EUR 506 |
ERMAP ORF Vector (Human) (pORF) |
ORF012935 |
ABM |
1.0 ug DNA |
EUR 354 |
Ermap sgRNA CRISPR Lentivector set (Mouse) |
K3499001 |
ABM |
3 x 1.0 ug |
EUR 339 |
ERMAP sgRNA CRISPR Lentivector set (Human) |
K0693301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody |
20-abx125825 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody |
abx037092-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody |
abx030390-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody |
abx030390-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody |
abx232850-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Ermap sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3499002 |
ABM |
1.0 ug DNA |
EUR 154 |
Ermap sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3499003 |
ABM |
1.0 ug DNA |
EUR 154 |
Ermap sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3499004 |
ABM |
1.0 ug DNA |
EUR 154 |
ERMAP sgRNA CRISPR Lentivector (Human) (Target 1) |
K0693302 |
ABM |
1.0 ug DNA |
EUR 154 |
ERMAP sgRNA CRISPR Lentivector (Human) (Target 2) |
K0693303 |
ABM |
1.0 ug DNA |
EUR 154 |
ERMAP sgRNA CRISPR Lentivector (Human) (Target 3) |
K0693304 |
ABM |
1.0 ug DNA |
EUR 154 |
ERMAP Protein Vector (Human) (pPB-C-His) |
PV051737 |
ABM |
500 ng |
EUR 481 |
ERMAP Protein Vector (Human) (pPB-N-His) |
PV051738 |
ABM |
500 ng |
EUR 481 |
ERMAP Protein Vector (Human) (pPM-C-HA) |
PV051739 |
ABM |
500 ng |
EUR 481 |
ERMAP Protein Vector (Human) (pPM-C-His) |
PV051740 |
ABM |
500 ng |
EUR 481 |
ERMAP Protein Vector (Mouse) (pPB-C-His) |
PV176266 |
ABM |
500 ng |
EUR 603 |
ERMAP Protein Vector (Mouse) (pPB-N-His) |
PV176267 |
ABM |
500 ng |
EUR 603 |
ERMAP Protein Vector (Mouse) (pPM-C-HA) |
PV176268 |
ABM |
500 ng |
EUR 603 |
ERMAP Protein Vector (Mouse) (pPM-C-His) |
PV176269 |
ABM |
500 ng |
EUR 603 |
Ermap 3'UTR Luciferase Stable Cell Line |
TU204090 |
ABM |
1.0 ml |
Ask for price |
Ermap 3'UTR GFP Stable Cell Line |
TU155935 |
ABM |
1.0 ml |
Ask for price |
ERMAP 3'UTR Luciferase Stable Cell Line |
TU007025 |
ABM |
1.0 ml |
EUR 1521 |
ERMAP Rabbit Polyclonal Antibody