DKKL1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
 DKKL1 Polyclonal Antibody |
|
ABP58379-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DKKL1 protein at amino acid sequence of 50-130
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DKKL1 from Human, Mouse. This DKKL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKKL1 protein at amino acid sequence of 50-130 |
DKKL1 Polyclonal Antibody |
|
A68134 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 DKKL1 antibody |
|
70R-7515 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal DKKL1 antibody |
 DKKL1 Antibody |
|
46552-100ul |
SAB |
100ul |
EUR 252 |
DKKL1 Antibody |
|
47058-100ul |
SAB |
100ul |
EUR 252 |
DKKL1 Antibody |
|
1-CSB-PA892450LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
) Polyclonal DKKL1 Antibody (C-term) |
|
AMM08616G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKKL1 (C-term). This antibody is tested and proven to work in the following applications: |
 DKKL1 Polyclonal Antibody, HRP Conjugated |
|
A68135 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 DKKL1 Polyclonal Antibody, FITC Conjugated |
|
A68136 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 DKKL1 Polyclonal Antibody, Biotin Conjugated |
|
A68137 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 DKKL1 Conjugated Antibody |
|
C46552 |
SAB |
100ul |
EUR 397 |
DKKL1 Conjugated Antibody |
|
C47058 |
SAB |
100ul |
EUR 397 |
 Anti-DKKL1 antibody |
|
STJ192351 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DKKL1 |
 DKKL1 siRNA |
|
20-abx914204 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DKKL1 siRNA |
|
20-abx914205 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-DKKL1 |
|
YF-PA18380 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to DKKL1 |
 DKKL1 Antibody, HRP conjugated |
|
1-CSB-PA892450LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 DKKL1 Antibody, FITC conjugated |
|
1-CSB-PA892450LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 DKKL1 Antibody, Biotin conjugated |
|
1-CSB-PA892450LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 DKKL1 Blocking Peptide |
|
33R-1858 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKKL1 antibody, catalog no. 70R-7515 |
 DKKL1 cloning plasmid |
|
CSB-CL892450HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 729
- Sequence: atgggagaagcctccccacctgcccccgcaaggcggcatctgctggtcctgctgctgctcctctctaccctggtgatcccctccgctgcagctcctatccatgatgctgacgcccaagagagctccttgggtctcacaggcctccagagcctactccaaggcttcagccgactttt
- Show more
|
|
Description: A cloning plasmid for the DKKL1 gene. |
 Antibody) Dickkopf-Like 1 (DKKL1) Antibody |
|
abx028492-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dickkopf-Like 1 (DKKL1) Antibody |
|
abx028492-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dickkopf-Like 1 (DKKL1) Antibody |
|
20-abx312308 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Mouse, Rat)) Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat) |
|
4-PAP091Ra01 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1) |
 Mouse DKKL1 shRNA Plasmid |
|
20-abx974096 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human DKKL1 shRNA Plasmid |
|
20-abx958974 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) DKKL1 Recombinant Protein (Human) |
|
RP009406 |
ABM |
100 ug |
Ask for price |
) DKKL1 Recombinant Protein (Rat) |
|
RP198122 |
ABM |
100 ug |
Ask for price |
) DKKL1 Recombinant Protein (Mouse) |
|
RP129140 |
ABM |
100 ug |
Ask for price |
 Antibody) Dickkopf Like Protein 1 (DKKL1) Antibody |
|
20-abx130376 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Antibody (HRP)) Dickkopf-Like 1 (DKKL1) Antibody (HRP) |
|
20-abx312309 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Dickkopf-Like 1 (DKKL1) Antibody (FITC) |
|
20-abx312310 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Dickkopf-Like 1 (DKKL1) Antibody (Biotin) |
|
20-abx312311 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Mouse, Rat), APC) Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), APC |
|
4-PAP091Ra01-APC |
Cloud-Clone |
-
EUR 388.00
-
EUR 3887.00
-
EUR 1065.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with APC. |
 Polyclonal Antibody (Mouse, Rat), Biotinylated) Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Biotinylated |
|
4-PAP091Ra01-Biotin |
Cloud-Clone |
-
EUR 343.00
-
EUR 2908.00
-
EUR 839.00
-
EUR 425.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Mouse, Rat), Cy3) Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Cy3 |
|
4-PAP091Ra01-Cy3 |
Cloud-Clone |
-
EUR 476.00
-
EUR 5141.00
-
EUR 1379.00
-
EUR 626.00
-
EUR 275.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Mouse, Rat), FITC) Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), FITC |
|
4-PAP091Ra01-FITC |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Mouse, Rat), HRP) Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), HRP |
|
4-PAP091Ra01-HRP |
Cloud-Clone |
-
EUR 353.00
-
EUR 3385.00
-
EUR 940.00
-
EUR 451.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Mouse, Rat), PE) Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), PE |
|
4-PAP091Ra01-PE |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with PE. |
DKKL1 Rabbit Polyclonal Antibody
