DKKL1 Rabbit Polyclonal Antibody
DKKL1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
DKKL1 Polyclonal Antibody |
ES11193-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DKKL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DKKL1 Polyclonal Antibody |
ES11193-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DKKL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DKKL1 Antibody |
47058-100ul |
SAB |
100ul |
EUR 252 |
DKKL1 Antibody |
46552-100ul |
SAB |
100ul |
EUR 252 |
DKKL1 Antibody |
1-CSB-PA892450LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
DKKL1 antibody |
70R-7515 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DKKL1 antibody |
Polyclonal DKKL1 Antibody (C-term) |
AMM08616G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKKL1 (C-term). This antibody is tested and proven to work in the following applications: |
DKKL1 Polyclonal Antibody, HRP Conjugated |
A68135 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
DKKL1 Polyclonal Antibody, FITC Conjugated |
A68136 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
DKKL1 Polyclonal Antibody, Biotin Conjugated |
A68137 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
DKKL1 Conjugated Antibody |
C46552 |
SAB |
100ul |
EUR 397 |
DKKL1 Conjugated Antibody |
C47058 |
SAB |
100ul |
EUR 397 |
Anti-DKKL1 antibody |
STJ192351 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DKKL1 |
DKKL1 siRNA |
20-abx914204 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DKKL1 siRNA |
20-abx914205 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DKKL1 |
YF-PA18380 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to DKKL1 |
DKKL1 Antibody, HRP conjugated |
1-CSB-PA892450LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DKKL1 Antibody, FITC conjugated |
1-CSB-PA892450LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DKKL1 Antibody, Biotin conjugated |
1-CSB-PA892450LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
DKKL1 Blocking Peptide |
33R-1858 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKKL1 antibody, catalog no. 70R-7515 |
DKKL1 cloning plasmid |
CSB-CL892450HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 729
- Sequence: atgggagaagcctccccacctgcccccgcaaggcggcatctgctggtcctgctgctgctcctctctaccctggtgatcccctccgctgcagctcctatccatgatgctgacgcccaagagagctccttgggtctcacaggcctccagagcctactccaaggcttcagccgactttt
- Show more
|
Description: A cloning plasmid for the DKKL1 gene. |
Dickkopf-Like 1 (DKKL1) Antibody |
abx028492-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dickkopf-Like 1 (DKKL1) Antibody |
abx028492-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dickkopf-Like 1 (DKKL1) Antibody |
20-abx312308 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat) |
4-PAP091Ra01 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1) |
Mouse DKKL1 shRNA Plasmid |
20-abx974096 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DKKL1 shRNA Plasmid |
20-abx958974 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DKKL1 Recombinant Protein (Human) |
RP009406 |
ABM |
100 ug |
Ask for price |
DKKL1 Recombinant Protein (Rat) |
RP198122 |
ABM |
100 ug |
Ask for price |
DKKL1 Recombinant Protein (Mouse) |
RP129140 |
ABM |
100 ug |
Ask for price |
Dickkopf Like Protein 1 (DKKL1) Antibody |
20-abx130376 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dickkopf-Like 1 (DKKL1) Antibody (HRP) |
20-abx312309 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dickkopf-Like 1 (DKKL1) Antibody (FITC) |
20-abx312310 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dickkopf-Like 1 (DKKL1) Antibody (Biotin) |
20-abx312311 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), APC |
4-PAP091Ra01-APC |
Cloud-Clone |
-
EUR 388.00
-
EUR 3887.00
-
EUR 1065.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with APC. |
Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAP091Ra01-Biotin |
Cloud-Clone |
-
EUR 343.00
-
EUR 2908.00
-
EUR 839.00
-
EUR 425.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Biotin. |
Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAP091Ra01-Cy3 |
Cloud-Clone |
-
EUR 476.00
-
EUR 5141.00
-
EUR 1379.00
-
EUR 626.00
-
EUR 275.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Cy3. |
Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAP091Ra01-FITC |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with FITC. |
Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAP091Ra01-HRP |
Cloud-Clone |
-
EUR 353.00
-
EUR 3385.00
-
EUR 940.00
-
EUR 451.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with HRP. |
Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), PE |
4-PAP091Ra01-PE |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKKL1 (Val21~Leu230)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with PE. |
DKKL1 Rabbit Polyclonal Antibody