LGMN Rabbit Polyclonal Antibody
LGMN Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
Human Legumain (LGMN) ELISA Kit |
RDR-LGMN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Legumain (LGMN) ELISA Kit |
RDR-LGMN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Legumain (LGMN) ELISA Kit |
RDR-LGMN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Legumain (LGMN) ELISA Kit |
RDR-LGMN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Legumain (LGMN) ELISA Kit |
RD-LGMN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Legumain (LGMN) ELISA Kit |
RD-LGMN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Legumain (LGMN) ELISA Kit |
RD-LGMN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Legumain (LGMN) ELISA Kit |
RD-LGMN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
LGMN Polyclonal Antibody |
27479-100ul |
SAB |
100ul |
EUR 252 |
LGMN Polyclonal Antibody |
27479-50ul |
SAB |
50ul |
EUR 187 |
LGMN Polyclonal Antibody |
A69571 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
LGMN Polyclonal Antibody |
ABP59112-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
- Applications tips:
|
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140 |
LGMN Polyclonal Antibody |
ABP59112-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
- Applications tips:
|
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140 |
LGMN Polyclonal Antibody |
ABP59112-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
- Applications tips:
|
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140 |
LGMN Polyclonal Antibody |
ES11326-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LGMN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LGMN Polyclonal Antibody |
ES11326-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LGMN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LGMN Rabbit pAb |
A10570-100ul |
Abclonal |
100 ul |
EUR 308 |
LGMN Rabbit pAb |
A10570-200ul |
Abclonal |
200 ul |
EUR 459 |
LGMN Rabbit pAb |
A10570-20ul |
Abclonal |
20 ul |
EUR 183 |
LGMN Rabbit pAb |
A10570-50ul |
Abclonal |
50 ul |
EUR 223 |
LGMN Polyclonal Conjugated Antibody |
C27479 |
SAB |
100ul |
EUR 397 |
LGMN Antibody |
1-CSB-PA012903LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000 |
Polyclonal LGMN Antibody (N-term) |
APR08220G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGMN (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal LGMN Antibody - middle region |
APR08221G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGMN - middle region. This antibody is tested and proven to work in the following applications: |
LGMN Polyclonal Antibody, HRP Conjugated |
A69572 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
LGMN Polyclonal Antibody, FITC Conjugated |
A69573 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
LGMN Polyclonal Antibody, Biotin Conjugated |
A69574 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
Legumain (LGMN) Polyclonal Antibody (Mouse) |
4-PAC564Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr435)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN) |
Legumain (LGMN) Polyclonal Antibody (Mouse), APC |
4-PAC564Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr435)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC. |
Legumain (LGMN) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC564Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr435)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Biotin. |
Legumain (LGMN) Polyclonal Antibody (Mouse), Cy3 |
4-PAC564Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr435)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Cy3. |
Legumain (LGMN) Polyclonal Antibody (Mouse), FITC |
4-PAC564Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr435)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with FITC. |
Legumain (LGMN) Polyclonal Antibody (Mouse), HRP |
4-PAC564Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr435)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with HRP. |
Legumain (LGMN) Polyclonal Antibody (Mouse), PE |
4-PAC564Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr435)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with PE. |
Legumain (LGMN) Antibody |
20-abx177320 |
Abbexa |
|
|
|
Legumain (LGMN) Antibody |
20-abx126093 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Legumain (LGMN) Antibody |
20-abx128416 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Legumain (LGMN) Antibody |
20-abx129426 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Legumain (LGMN) Antibody |
abx145639-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Legumain (LGMN) Antibody |
20-abx173322 |
Abbexa |
|
|
|
Legumain (LGMN) Antibody |
abx031307-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Legumain (LGMN) Antibody |
abx031307-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Legumain (LGMN) Antibody |
20-abx334421 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-LGMN antibody |
STJ112585 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform. |
Anti-LGMN antibody |
STJ192484 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LGMN |
Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat) |
4-PAC564Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr433)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN) |
Legumain (LGMN) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC564Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr435)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC-Cy7. |
LGMN protein |
80R-4392 |
Fitzgerald |
50 ug |
EUR 349 |
Description: Purified Recombinant LGMN protein |
LGMN siRNA |
20-abx902970 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LGMN siRNA |
20-abx922498 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LGMN siRNA |
20-abx922499 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LGMN Antibody, HRP conjugated |
1-CSB-PA012903LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LGMN Antibody, FITC conjugated |
1-CSB-PA012903LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LGMN Antibody, Biotin conjugated |
1-CSB-PA012903LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Legumain (LGMN) Antibody (HRP) |
20-abx336315 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Legumain (LGMN) Antibody (FITC) |
20-abx336316 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Legumain (LGMN) Antibody (Biotin) |
20-abx336317 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC |
4-PAC564Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr433)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC. |
Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated |
4-PAC564Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr433)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Biotin. |
Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Cy3 |
4-PAC564Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr433)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Cy3. |
Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), FITC |
4-PAC564Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr433)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with FITC. |
Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), HRP |
4-PAC564Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr433)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with HRP. |
Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), PE |
4-PAC564Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr433)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with PE. |
Human Legumain (LGMN) |
1-CSB-EP012903HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 38.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Legumain(LGMN) expressed in E.coli |
Mouse Legumain (Lgmn) |
1-CSB-EP012903MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 38.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Legumain(Lgmn) expressed in E.coli |
Human Legumain (LGMN) |
1-CSB-YP012903HU |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 36.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Legumain(LGMN) expressed in Yeast |
Mouse Legumain (Lgmn) |
1-CSB-YP012903MO |
Cusabio |
-
EUR 586.00
-
EUR 299.00
-
EUR 2172.00
-
EUR 900.00
-
EUR 1442.00
-
EUR 382.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 36.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Legumain(Lgmn) expressed in Yeast |
LGMN cloning plasmid |
CSB-CL012903HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1302
- Sequence: atggtttggaaagtagctgtattcctcagtgtggccctgggcattggtgccattcctatagatgatcctgaagatggaggcaagcactgggtggtgatcgtggcaggttcaaatggctggtataattataggcaccaggcagacgcgtgccatgcctaccagatcattcaccgca
- Show more
|
Description: A cloning plasmid for the LGMN gene. |
Recombinant Legumain (LGMN) |
4-RPC564Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99538
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Legumain expressed in: E.coli |
Recombinant Legumain (LGMN) |
4-RPC564Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O89017
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.3KDa
- Isoelectric Point: 5.9
|
Description: Recombinant Mouse Legumain expressed in: E.coli |
Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7 |
4-PAC564Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LGMN (Val18~Tyr433)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC-Cy7. |
Macaca fascicularis Legumain (LGMN) |
1-CSB-EP012903MOV |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 39.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Macaca fascicularis Legumain(LGMN) expressed in E.coli |
Human Legumain (LGMN) Protein |
20-abx166733 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Legumain (LGMN) Protein |
20-abx167282 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse LGMN shRNA Plasmid |
20-abx972224 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat LGMN shRNA Plasmid |
20-abx986104 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LGMN shRNA Plasmid |
20-abx953802 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Macaca fascicularis Legumain (LGMN) |
1-CSB-BP012903MOVb1 |
Cusabio |
-
EUR 840.00
-
EUR 332.00
-
EUR 2170.00
-
EUR 1135.00
-
EUR 1579.00
-
EUR 470.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 38.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Macaca fascicularis Legumain(LGMN) expressed in Baculovirus |
LGMN Recombinant Protein (Human) |
RP017755 |
ABM |
100 ug |
Ask for price |
LGMN Recombinant Protein (Rat) |
RP208091 |
ABM |
100 ug |
Ask for price |
LGMN Recombinant Protein (Mouse) |
RP147344 |
ABM |
100 ug |
Ask for price |
Monoclonal LGMN Antibody (monoclonal) (M02), Clone: M1 |
APR08219G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human LGMN (monoclonal) (M02). The antibodies are raised in mouse and are from clone M1. This antibody is applicable in E |
Human Legumain(LGMN) ELISA kit |
CSB-EL012903HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human Legumain (LGMN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Legumain(LGMN) ELISA kit |
1-CSB-EL012903HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human Legumain(LGMN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Legumain (LGMN) ELISA Kit |
20-abx154315 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Legumain (LGMN) ELISA Kit |
20-abx152188 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Cow Legumain (LGMN) ELISA Kit |
abx257255-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Lgmn/ Legumain ELISA Kit |
E0866Mo |
Sunlong |
1 Kit |
EUR 571 |
Human LGMN/ Legumain ELISA Kit |
E1457Hu |
Sunlong |
1 Kit |
EUR 571 |
Bovine LGMN(Legumain) ELISA Kit |
EB0051 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q95M12
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 46.9pg/ml |
Human LGMN(Legumain) ELISA Kit |
EH1372 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q99538
- Alias: LGMN(Legumain)/AEP/LGMN1/PRSC1/Protease, cysteine 1/Asparaginyl Endopeptidase/cysteine protease 1/legumain/protease, cysteine, 1(legumain)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Mouse Legumain (LGMN) ELISA Kit |
abx571481-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Legumain (LGMN) ELISA Kit |
abx572419-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Legumain (LGMN) ELISA Kit |
abx515751-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Legumain (LGMN) CLIA Kit |
20-abx493769 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Legumain (LGMN) CLIA Kit |
20-abx493770 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Lgmn ORF Vector (Rat) (pORF) |
ORF069365 |
ABM |
1.0 ug DNA |
EUR 506 |
LGMN ORF Vector (Human) (pORF) |
ORF005919 |
ABM |
1.0 ug DNA |
EUR 95 |
Lgmn ORF Vector (Mouse) (pORF) |
ORF049116 |
ABM |
1.0 ug DNA |
EUR 506 |
LGMN Legumain Human Recombinant Protein |
PROTQ99538 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: LGMN produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (18-433 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 422 amino acids and having a molecular mass of 48.4kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa).;LGMN is purified by proprietary chromatographic techniques. |
LGMN Legumain Mouse Recombinant Protein |
PROTO89017 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: LGMN produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 426 amino acids (18-435a.a.) and having a molecular mass of 48.6kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). LGMN is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Human Legumain (LGMN) ELISA Kit |
SEC564Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Legumain (LGMN) ELISA Kit |
SEC564Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Legumain (LGMN) ELISA Kit |
SEC564Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Legumain (LGMN) ELISA Kit |
SEC564Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Legumain (LGMN) ELISA Kit |
4-SEC564Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Legumain elisa. Alternative names of the recognized antigen: AEP
- LGMN1
- PRSC1
- Protease, Cysteine 1
- Asparaginyl endopeptidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Legumain (LGMN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Legumain (LGMN) ELISA Kit |
SEC564Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Legumain (LGMN) ELISA Kit |
SEC564Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Legumain (LGMN) ELISA Kit |
SEC564Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Legumain (LGMN) ELISA Kit |
SEC564Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Legumain (LGMN) ELISA Kit |
4-SEC564Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Legumain elisa. Alternative names of the recognized antigen: AEP
- LGMN1
- PRSC1
- Protease, Cysteine 1
- Asparaginyl endopeptidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Legumain (LGMN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
LGMN ELISA Kit (Mouse) (OKCD02687) |
OKCD02687 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL |
LGMN ELISA Kit (Human) (OKBB01091) |
OKBB01091 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Legumain (asparaginyl endopeptidase, citvac, proteinase B, hemoglobinase, PRSC1 gene product or LGMN (Homo sapiens), vicilin peptidohydrolase, bean endopeptidase) is an enzyme that in humans is encoded by the LGMN gene (previous symbolPRSC1). Using fluorescence in situ hybridization, the LGMN gene was mapped to chromosome 14q32.1. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Lgmn ELISA Kit (Mouse) (OKBB01092) |
OKBB01092 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Legumain (asparaginyl endopeptidase, citvac, proteinase B, hemoglobinase, PRSC1 gene product or LGMN (Homo sapiens), vicilin peptidohydrolase, bean endopeptidase) is an enzyme that in humans is encoded by the LGMN gene (previous symbolPRSC1). Using fluorescence in situ hybridization, the LGMN gene was mapped to chromosome 14q32.1. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Lgmn ELISA Kit (Rat) (OKBB01467) |
OKBB01467 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Legumain is a protein that in humans is encoded by the LGMN gene. It is mapped to 6q32. This gene encodes a cysteine protease, legumain, that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
LGMN ELISA Kit (Human) (OKCD08182) |
OKCD08182 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.123ng/mL |
LGMN ELISA Kit (Human) (OKEH00861) |
OKEH00861 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL |
LGMN ELISA Kit (Rat) (OKEH06205) |
OKEH06205 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL |
LGMN ELISA Kit (Mouse) (OKEH07038) |
OKEH07038 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41 pg/mL |
ELISA kit for Human LGMN (Legumain) |
ELK3223 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Legumain (LGMN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Legumain (LGMN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Legumain from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse LGMN (Legumain) |
ELK6820 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Legumain (LGMN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Legumain (LGMN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Legumain from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Lgmn sgRNA CRISPR Lentivector set (Rat) |
K6909401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lgmn sgRNA CRISPR Lentivector set (Mouse) |
K3716501 |
ABM |
3 x 1.0 ug |
EUR 339 |
LGMN sgRNA CRISPR Lentivector set (Human) |
K1211801 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Mouse Legumain (LGMN) |
KTE71475-48T |
Abbkine |
48T |
EUR 332 |
- Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Legumain (LGMN) |
KTE71475-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Legumain (LGMN) |
KTE71475-96T |
Abbkine |
96T |
EUR 539 |
- Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Legumain (LGMN) |
KTE61817-48T |
Abbkine |
48T |
EUR 332 |
- Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Legumain (LGMN) |
KTE61817-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Legumain (LGMN) |
KTE61817-96T |
Abbkine |
96T |
EUR 539 |
- Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Lgmn sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6909402 |
ABM |
1.0 ug DNA |
EUR 154 |
Lgmn sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6909403 |
ABM |
1.0 ug DNA |
EUR 154 |
Lgmn sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6909404 |
ABM |
1.0 ug DNA |
EUR 154 |
Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3716502 |
ABM |
1.0 ug DNA |
EUR 154 |
Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3716503 |
ABM |
1.0 ug DNA |
EUR 154 |
Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3716504 |
ABM |
1.0 ug DNA |
EUR 154 |
LGMN sgRNA CRISPR Lentivector (Human) (Target 1) |
K1211802 |
ABM |
1.0 ug DNA |
EUR 154 |
LGMN sgRNA CRISPR Lentivector (Human) (Target 2) |
K1211803 |
ABM |
1.0 ug DNA |
EUR 154 |
LGMN sgRNA CRISPR Lentivector (Human) (Target 3) |
K1211804 |
ABM |
1.0 ug DNA |
EUR 154 |
LGMN Protein Vector (Human) (pPB-C-His) |
PV023673 |
ABM |
500 ng |
EUR 329 |
LGMN Protein Vector (Human) (pPB-N-His) |
PV023674 |
ABM |
500 ng |
EUR 329 |
LGMN Protein Vector (Human) (pPM-C-HA) |
PV023675 |
ABM |
500 ng |
EUR 329 |
LGMN Protein Vector (Human) (pPM-C-His) |
PV023676 |
ABM |
500 ng |
EUR 329 |
LGMN Protein Vector (Rat) (pPB-C-His) |
PV277458 |
ABM |
500 ng |
EUR 603 |
LGMN Protein Vector (Rat) (pPB-N-His) |
PV277459 |
ABM |
500 ng |
EUR 603 |
LGMN Protein Vector (Rat) (pPM-C-HA) |
PV277460 |
ABM |
500 ng |
EUR 603 |
LGMN Protein Vector (Rat) (pPM-C-His) |
PV277461 |
ABM |
500 ng |
EUR 603 |
LGMN Protein Vector (Mouse) (pPB-C-His) |
PV196462 |
ABM |
500 ng |
EUR 603 |
LGMN Protein Vector (Mouse) (pPB-N-His) |
PV196463 |
ABM |
500 ng |
EUR 603 |
LGMN Protein Vector (Mouse) (pPM-C-HA) |
PV196464 |
ABM |
500 ng |
EUR 603 |
LGMN Protein Vector (Mouse) (pPM-C-His) |
PV196465 |
ABM |
500 ng |
EUR 603 |
Lgmn 3'UTR Luciferase Stable Cell Line |
TU111027 |
ABM |
1.0 ml |
Ask for price |
Lgmn 3'UTR GFP Stable Cell Line |
TU161027 |
ABM |
1.0 ml |
Ask for price |
Lgmn 3'UTR Luciferase Stable Cell Line |
TU207045 |
ABM |
1.0 ml |
Ask for price |
Lgmn 3'UTR GFP Stable Cell Line |
TU257045 |
ABM |
1.0 ml |
Ask for price |
LGMN 3'UTR GFP Stable Cell Line |
TU062424 |
ABM |
1.0 ml |
EUR 1394 |
LGMN 3'UTR Luciferase Stable Cell Line |
TU012424 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
LGMN Rabbit Polyclonal Antibody