LGMN Rabbit Polyclonal Antibody

LGMN Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

Human Legumain (LGMN) ELISA Kit

RDR-LGMN-Hu-48Tests 48 Tests
EUR 544

Human Legumain (LGMN) ELISA Kit

RDR-LGMN-Hu-96Tests 96 Tests
EUR 756

Mouse Legumain (LGMN) ELISA Kit

RDR-LGMN-Mu-48Tests 48 Tests
EUR 557

Mouse Legumain (LGMN) ELISA Kit

RDR-LGMN-Mu-96Tests 96 Tests
EUR 774

Human Legumain (LGMN) ELISA Kit

RD-LGMN-Hu-48Tests 48 Tests
EUR 521

Human Legumain (LGMN) ELISA Kit

RD-LGMN-Hu-96Tests 96 Tests
EUR 723

Mouse Legumain (LGMN) ELISA Kit

RD-LGMN-Mu-48Tests 48 Tests
EUR 533

Mouse Legumain (LGMN) ELISA Kit

RD-LGMN-Mu-96Tests 96 Tests
EUR 740

LGMN Polyclonal Antibody

27479-100ul 100ul
EUR 252

LGMN Polyclonal Antibody

27479-50ul 50ul
EUR 187

LGMN Polyclonal Antibody

A69571 100 ?g
EUR 628.55
Description: The best epigenetics products

LGMN Polyclonal Antibody

ABP59112-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody

ABP59112-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody

ABP59112-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody

ES11326-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LGMN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LGMN Polyclonal Antibody

ES11326-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LGMN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LGMN Rabbit pAb

A10570-100ul 100 ul
EUR 308

LGMN Rabbit pAb

A10570-200ul 200 ul
EUR 459

LGMN Rabbit pAb

A10570-20ul 20 ul
EUR 183

LGMN Rabbit pAb

A10570-50ul 50 ul
EUR 223

LGMN Polyclonal Conjugated Antibody

C27479 100ul
EUR 397

LGMN Antibody

1-CSB-PA012903LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

Polyclonal LGMN Antibody (N-term)

APR08220G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGMN (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal LGMN Antibody - middle region

APR08221G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGMN - middle region. This antibody is tested and proven to work in the following applications:

LGMN Polyclonal Antibody, HRP Conjugated

A69572 100 ?g
EUR 628.55
Description: kits suitable for this type of research

LGMN Polyclonal Antibody, FITC Conjugated

A69573 100 ?g
EUR 628.55
Description: fast delivery possible

LGMN Polyclonal Antibody, Biotin Conjugated

A69574 100 ?g
EUR 628.55
Description: reagents widely cited

Legumain (LGMN) Polyclonal Antibody (Mouse)

4-PAC564Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN)

Legumain (LGMN) Polyclonal Antibody (Mouse), APC

4-PAC564Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC.

Legumain (LGMN) Polyclonal Antibody (Mouse), Biotinylated

4-PAC564Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Biotin.

Legumain (LGMN) Polyclonal Antibody (Mouse), Cy3

4-PAC564Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Cy3.

Legumain (LGMN) Polyclonal Antibody (Mouse), FITC

4-PAC564Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with FITC.

Legumain (LGMN) Polyclonal Antibody (Mouse), HRP

4-PAC564Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with HRP.

Legumain (LGMN) Polyclonal Antibody (Mouse), PE

4-PAC564Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with PE.

Legumain (LGMN) Antibody

20-abx177320
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Legumain (LGMN) Antibody

20-abx126093
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

20-abx128416
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Legumain (LGMN) Antibody

20-abx129426
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Legumain (LGMN) Antibody

abx145639-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

20-abx173322
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Legumain (LGMN) Antibody

abx031307-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

abx031307-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

20-abx334421
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-LGMN antibody

STJ112585 100 µl
EUR 277
Description: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.

Anti-LGMN Antibody

STJ501591 100 µg
EUR 476

Anti-LGMN antibody

STJ192484 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LGMN

Lgmn/ Rat Lgmn ELISA Kit

ELI-03979r 96 Tests
EUR 886

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat)

4-PAC564Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN)

Legumain (LGMN) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC564Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC-Cy7.

LGMN protein

80R-4392 50 ug
EUR 349
Description: Purified Recombinant LGMN protein

LGMN siRNA

20-abx902970
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LGMN siRNA

20-abx922498
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LGMN siRNA

20-abx922499
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LGMN Antibody, HRP conjugated

1-CSB-PA012903LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LGMN Antibody, FITC conjugated

1-CSB-PA012903LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LGMN Antibody, Biotin conjugated

1-CSB-PA012903LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Legumain (LGMN) Antibody (HRP)

20-abx336315
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody (FITC)

20-abx336316
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody (Biotin)

20-abx336317
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-LGMN Antibody (Biotin)

STJ501592 100 µg
EUR 586

Anti-LGMN Antibody (FITC)

STJ501593 100 µg
EUR 586

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAC564Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAC564Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Biotin.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAC564Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Cy3.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAC564Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with FITC.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAC564Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with HRP.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAC564Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with PE.

Human Legumain (LGMN)

1-CSB-EP012903HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Legumain(LGMN) expressed in E.coli

Mouse Legumain (Lgmn)

1-CSB-EP012903MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Legumain(Lgmn) expressed in E.coli

Human Legumain (LGMN)

1-CSB-YP012903HU
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Legumain(LGMN) expressed in Yeast

Mouse Legumain (Lgmn)

1-CSB-YP012903MO
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Legumain(Lgmn) expressed in Yeast

LGMN cloning plasmid

CSB-CL012903HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atggtttggaaagtagctgtattcctcagtgtggccctgggcattggtgccattcctatagatgatcctgaagatggaggcaagcactgggtggtgatcgtggcaggttcaaatggctggtataattataggcaccaggcagacgcgtgccatgcctaccagatcattcaccgca
  • Show more
Description: A cloning plasmid for the LGMN gene.

Recombinant Legumain (LGMN)

4-RPC564Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99538
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Legumain expressed in: E.coli

Recombinant Legumain (LGMN)

4-RPC564Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O89017
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.3KDa
  • Isoelectric Point: 5.9
Description: Recombinant Mouse Legumain expressed in: E.coli

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

4-PAC564Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC-Cy7.

Macaca fascicularis Legumain (LGMN)

1-CSB-EP012903MOV
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Macaca fascicularis Legumain(LGMN) expressed in E.coli

Human Legumain (LGMN) Protein

20-abx166733
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Legumain (LGMN) Protein

20-abx167282
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human LGMN ELISA Kit

ELA-E1201h 96 Tests
EUR 824

LGMN ELISA KIT|Human

EF004361 96 Tests
EUR 689

Mouse LGMN shRNA Plasmid

20-abx972224
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat LGMN shRNA Plasmid

20-abx986104
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LGMN shRNA Plasmid

20-abx953802
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Macaca fascicularis Legumain (LGMN)

1-CSB-BP012903MOVb1
  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Macaca fascicularis Legumain(LGMN) expressed in Baculovirus

LGMN Recombinant Protein (Human)

RP017755 100 ug Ask for price

LGMN Recombinant Protein (Rat)

RP208091 100 ug Ask for price

LGMN Recombinant Protein (Mouse)

RP147344 100 ug Ask for price

Monoclonal LGMN Antibody (monoclonal) (M02), Clone: M1

APR08219G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human LGMN (monoclonal) (M02). The antibodies are raised in mouse and are from clone M1. This antibody is applicable in E

Human Legumain(LGMN) ELISA kit

CSB-EL012903HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Legumain (LGMN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Legumain(LGMN) ELISA kit

1-CSB-EL012903HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Legumain(LGMN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Legumain (LGMN) ELISA Kit

20-abx154315
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Legumain (LGMN) ELISA Kit

20-abx152188
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Cow Legumain (LGMN) ELISA Kit

abx257255-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Lgmn/ Legumain ELISA Kit

E0866Mo 1 Kit
EUR 571

Human LGMN/ Legumain ELISA Kit

E1457Hu 1 Kit
EUR 571

Bovine LGMN(Legumain) ELISA Kit

EB0051 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q95M12
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 46.9pg/ml

Human LGMN(Legumain) ELISA Kit

EH1372 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q99538
  • Alias: LGMN(Legumain)/AEP/LGMN1/PRSC1/Protease, cysteine 1/Asparaginyl Endopeptidase/cysteine protease 1/legumain/protease, cysteine, 1(legumain)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Bovine Legumain, LGMN ELISA KIT

ELI-03977b 96 Tests
EUR 928

Human Legumain, LGMN ELISA KIT

ELI-03978h 96 Tests
EUR 824

Mouse Legumain, Lgmn ELISA KIT

ELI-03980m 96 Tests
EUR 865

Mouse Legumain (LGMN) ELISA Kit

abx571481-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Legumain (LGMN) ELISA Kit

abx572419-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Legumain (LGMN) ELISA Kit

abx515751-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Legumain (LGMN) CLIA Kit

20-abx493769
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Legumain (LGMN) CLIA Kit

20-abx493770
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Lgmn ORF Vector (Rat) (pORF)

ORF069365 1.0 ug DNA
EUR 506

LGMN ORF Vector (Human) (pORF)

ORF005919 1.0 ug DNA
EUR 95

Lgmn ORF Vector (Mouse) (pORF)

ORF049116 1.0 ug DNA
EUR 506

LGMN Legumain Human Recombinant Protein

PROTQ99538 Regular: 10ug
EUR 317
Description: LGMN produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (18-433 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 422 amino acids and having a molecular mass of 48.4kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa).;LGMN is purified by proprietary chromatographic techniques.

LGMN Legumain Mouse Recombinant Protein

PROTO89017 Regular: 10ug
EUR 317
Description: LGMN produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 426 amino acids (18-435a.a.) and having a molecular mass of 48.6kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). LGMN is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Human Legumain(LGMN)ELISA Kit

QY-E01245 96T
EUR 361

Human Legumain (LGMN) ELISA Kit

SEC564Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit

SEC564Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit

SEC564Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit

SEC564Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit

4-SEC564Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Legumain elisa. Alternative names of the recognized antigen: AEP
  • LGMN1
  • PRSC1
  • Protease, Cysteine 1
  • Asparaginyl endopeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Legumain (LGMN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Legumain (LGMN) ELISA Kit

SEC564Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

SEC564Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

SEC564Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

SEC564Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

4-SEC564Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Legumain elisa. Alternative names of the recognized antigen: AEP
  • LGMN1
  • PRSC1
  • Protease, Cysteine 1
  • Asparaginyl endopeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Legumain (LGMN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

LGMN ELISA Kit (Mouse) (OKCD02687)

OKCD02687 96 Wells
EUR 857
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

LGMN ELISA Kit (Human) (OKBB01091)

OKBB01091 96 Wells
EUR 505
Description: Description of target: Legumain (asparaginyl endopeptidase, citvac, proteinase B, hemoglobinase, PRSC1 gene product or LGMN (Homo sapiens), vicilin peptidohydrolase, bean endopeptidase) is an enzyme that in humans is encoded by the LGMN gene (previous symbolPRSC1). Using fluorescence in situ hybridization, the LGMN gene was mapped to chromosome 14q32.1. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Lgmn ELISA Kit (Mouse) (OKBB01092)

OKBB01092 96 Wells
EUR 505
Description: Description of target: Legumain (asparaginyl endopeptidase, citvac, proteinase B, hemoglobinase, PRSC1 gene product or LGMN (Homo sapiens), vicilin peptidohydrolase, bean endopeptidase) is an enzyme that in humans is encoded by the LGMN gene (previous symbolPRSC1). Using fluorescence in situ hybridization, the LGMN gene was mapped to chromosome 14q32.1. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Lgmn ELISA Kit (Rat) (OKBB01467)

OKBB01467 96 Wells
EUR 505
Description: Description of target: Legumain is a protein that in humans is encoded by the LGMN gene. It is mapped to 6q32. This gene encodes a cysteine protease, legumain, that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

LGMN ELISA Kit (Human) (OKCD08182)

OKCD08182 96 Wells
EUR 975
Description: Description of target: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.123ng/mL

LGMN ELISA Kit (Human) (OKEH00861)

OKEH00861 96 Wells
EUR 662
Description: Description of target: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

LGMN ELISA Kit (Rat) (OKEH06205)

OKEH06205 96 Wells
EUR 662
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

LGMN ELISA Kit (Mouse) (OKEH07038)

OKEH07038 96 Wells
EUR 662
Description: Description of target: Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. May be involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41 pg/mL

ELISA kit for Human LGMN (Legumain)

ELK3223 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Legumain (LGMN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Legumain (LGMN). N
  • Show more
Description: A sandwich ELISA kit for detection of Legumain from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse LGMN (Legumain)

ELK6820 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Legumain (LGMN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Legumain (LGMN). N
  • Show more
Description: A sandwich ELISA kit for detection of Legumain from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Lgmn sgRNA CRISPR Lentivector set (Rat)

K6909401 3 x 1.0 ug
EUR 339

Lgmn sgRNA CRISPR Lentivector set (Mouse)

K3716501 3 x 1.0 ug
EUR 339

LGMN sgRNA CRISPR Lentivector set (Human)

K1211801 3 x 1.0 ug
EUR 339

ELISA kit for Mouse Legumain (LGMN)

KTE71475-48T 48T
EUR 332
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Legumain (LGMN)

KTE71475-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Legumain (LGMN)

KTE71475-96T 96T
EUR 539
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Legumain (LGMN)

KTE61817-48T 48T
EUR 332
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Legumain (LGMN)

KTE61817-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Legumain (LGMN)

KTE61817-96T 96T
EUR 539
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

LGMN ELISA Kit| Bovine Legumain ELISA Kit

EF011005 96 Tests
EUR 689

Lgmn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6909402 1.0 ug DNA
EUR 154

Lgmn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6909403 1.0 ug DNA
EUR 154

Lgmn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6909404 1.0 ug DNA
EUR 154

Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3716502 1.0 ug DNA
EUR 154

Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3716503 1.0 ug DNA
EUR 154

Lgmn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3716504 1.0 ug DNA
EUR 154

LGMN sgRNA CRISPR Lentivector (Human) (Target 1)

K1211802 1.0 ug DNA
EUR 154

LGMN sgRNA CRISPR Lentivector (Human) (Target 2)

K1211803 1.0 ug DNA
EUR 154

LGMN sgRNA CRISPR Lentivector (Human) (Target 3)

K1211804 1.0 ug DNA
EUR 154

LGMN Protein Vector (Human) (pPB-C-His)

PV023673 500 ng
EUR 329

LGMN Protein Vector (Human) (pPB-N-His)

PV023674 500 ng
EUR 329

LGMN Protein Vector (Human) (pPM-C-HA)

PV023675 500 ng
EUR 329

LGMN Protein Vector (Human) (pPM-C-His)

PV023676 500 ng
EUR 329

LGMN Protein Vector (Rat) (pPB-C-His)

PV277458 500 ng
EUR 603

LGMN Protein Vector (Rat) (pPB-N-His)

PV277459 500 ng
EUR 603

LGMN Protein Vector (Rat) (pPM-C-HA)

PV277460 500 ng
EUR 603

LGMN Protein Vector (Rat) (pPM-C-His)

PV277461 500 ng
EUR 603

LGMN Protein Vector (Mouse) (pPB-C-His)

PV196462 500 ng
EUR 603

LGMN Protein Vector (Mouse) (pPB-N-His)

PV196463 500 ng
EUR 603

LGMN Protein Vector (Mouse) (pPM-C-HA)

PV196464 500 ng
EUR 603

LGMN Protein Vector (Mouse) (pPM-C-His)

PV196465 500 ng
EUR 603

Lgmn 3'UTR Luciferase Stable Cell Line

TU111027 1.0 ml Ask for price

Lgmn 3'UTR GFP Stable Cell Line

TU161027 1.0 ml Ask for price

Lgmn 3'UTR Luciferase Stable Cell Line

TU207045 1.0 ml Ask for price

Lgmn 3'UTR GFP Stable Cell Line

TU257045 1.0 ml Ask for price

LGMN 3'UTR GFP Stable Cell Line

TU062424 1.0 ml
EUR 1394

LGMN 3'UTR Luciferase Stable Cell Line

TU012424 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

LGMN Rabbit Polyclonal Antibody