NIPA1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

NIPA1 Polyclonal Antibody
ABP59468-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NIPA1 protein at amino acid sequence of 111-160 Applications tips:
Description: A polyclonal antibody for detection of NIPA1 from Human, Mouse. This NIPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NIPA1 protein at amino acid sequence of 111-160

NIPA1 Antibody
43886-100ul	SAB	100ul	EUR 252

NIPA1 Conjugated Antibody
C43886	SAB	100ul	EUR 397

Anti-NIPA1 antibody
STJ192600	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NIPA1

NIPA1 siRNA
20-abx925917	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NIPA1 siRNA
20-abx925918	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Mouse Magnesium transporter NIPA1, Nipa1 ELISA KIT
ELI-15093m	Lifescience Market	96 Tests	EUR 865

Human Magnesium transporter NIPA1, NIPA1 ELISA KIT
ELI-44030h	Lifescience Market	96 Tests	EUR 824

NIPA1 cloning plasmid
CSB-CL742399HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 765 Sequence: atggctgttggccagattggaaacttcctggcttacacggcggtccccacggtcctggtaacccccctgggcgcccttggagtaccgttcgggtccattttagcttcctatctcctgaaggaaaagctcaacatcttgggcaagttggggtgcctgctaagctgtgcaggctccgt Show more
Description: A cloning plasmid for the NIPA1 gene.

Human NIPA1 shRNA Plasmid
20-abx964733	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NIPA1 shRNA Plasmid
20-abx982047	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NIPA1 Recombinant Protein (Human)
RP021247	ABM	100 ug	Ask for price

NIPA1 Recombinant Protein (Rat)
RP213947	ABM	100 ug	Ask for price

pCMV-SPORT6-NIPA1 Plasmid
PVT16286	Lifescience Market	2 ug	EUR 325

NIPA1 Recombinant Protein (Mouse)
RP154127	ABM	100 ug	Ask for price

NIPA1 ORF Vector (Human) (pORF)
ORF007083	ABM	1.0 ug DNA	EUR 95

Nipa1 ORF Vector (Rat) (pORF)
ORF071317	ABM	1.0 ug DNA	EUR 506

Nipa1 ORF Vector (Mouse) (pORF)
ORF051377	ABM	1.0 ug DNA	EUR 506

NIPA1 ELISA Kit (Human) (OKCD02024)
OKCD02024	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Acts as a Mg2+ transporter. Can also transport other divalent cations such as Fe2+, Sr2+, Ba2+, Mn2+ and Co2+ but to a much less extent than Mg2+.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

NIPA1 sgRNA CRISPR Lentivector set (Human)
K1428001	ABM	3 x 1.0 ug	EUR 339

Nipa1 sgRNA CRISPR Lentivector set (Mouse)
K3745301	ABM	3 x 1.0 ug	EUR 339

Nipa1 sgRNA CRISPR Lentivector set (Rat)
K6714401	ABM	3 x 1.0 ug	EUR 339

NIPA1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1428002	ABM	1.0 ug DNA	EUR 154

NIPA1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1428003	ABM	1.0 ug DNA	EUR 154

NIPA1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1428004	ABM	1.0 ug DNA	EUR 154

Nipa1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3745302	ABM	1.0 ug DNA	EUR 154

Nipa1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3745303	ABM	1.0 ug DNA	EUR 154

Nipa1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3745304	ABM	1.0 ug DNA	EUR 154

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6714402	ABM	1.0 ug DNA	EUR 154

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6714403	ABM	1.0 ug DNA	EUR 154

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6714404	ABM	1.0 ug DNA	EUR 154

NIPA1 Protein Vector (Rat) (pPB-C-His)
PV285266	ABM	500 ng	EUR 603

NIPA1 Protein Vector (Rat) (pPB-N-His)
PV285267	ABM	500 ng	EUR 603

NIPA1 Protein Vector (Rat) (pPM-C-HA)
PV285268	ABM	500 ng	EUR 603

NIPA1 Protein Vector (Rat) (pPM-C-His)
PV285269	ABM	500 ng	EUR 603

NIPA1 Protein Vector (Human) (pPB-C-His)
PV028329	ABM	500 ng	EUR 329

NIPA1 Protein Vector (Human) (pPB-N-His)
PV028330	ABM	500 ng	EUR 329

NIPA1 Protein Vector (Human) (pPM-C-HA)
PV028331	ABM	500 ng	EUR 329

NIPA1 Protein Vector (Human) (pPM-C-His)
PV028332	ABM	500 ng	EUR 329

NIPA1 Protein Vector (Mouse) (pPB-C-His)
PV205506	ABM	500 ng	EUR 603

NIPA1 Protein Vector (Mouse) (pPB-N-His)
PV205507	ABM	500 ng	EUR 603

NIPA1 Protein Vector (Mouse) (pPM-C-HA)
PV205508	ABM	500 ng	EUR 603

NIPA1 Protein Vector (Mouse) (pPM-C-His)
PV205509	ABM	500 ng	EUR 603

Nipa1 3'UTR GFP Stable Cell Line
TU164091	ABM	1.0 ml	Ask for price

Nipa1 3'UTR Luciferase Stable Cell Line
TU213982	ABM	1.0 ml	Ask for price

NIPA1 3'UTR Luciferase Stable Cell Line
TU015691	ABM	1.0 ml	EUR 4617

Nipa1 3'UTR Luciferase Stable Cell Line
TU114091	ABM	1.0 ml	Ask for price

NIPA1 3'UTR GFP Stable Cell Line
TU065691	ABM	1.0 ml	EUR 4617

Nipa1 3'UTR GFP Stable Cell Line
TU263982	ABM	1.0 ml	Ask for price

NIPA1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV659431	ABM	1.0 ug DNA	EUR 514

NIPA1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV659435	ABM	1.0 ug DNA	EUR 514

NIPA1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV659436	ABM	1.0 ug DNA	EUR 514

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NIPA1 Rabbit Polyclonal Antibody