MFAP5 Rabbit Polyclonal Antibody

MFAP5 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

MFAP5 Polyclonal Antibody

ABP59265-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of MFAP5 from Human, Mouse. This MFAP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90

MFAP5 Polyclonal Antibody

ABP59265-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of MFAP5 from Human, Mouse. This MFAP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90

MFAP5 Polyclonal Antibody

ABP59265-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of MFAP5 from Human, Mouse. This MFAP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90

MFAP5 Polyclonal Antibody

A56134 100 µg
EUR 570.55
Description: kits suitable for this type of research

MFAP5 Antibody

37713-100ul 100ul
EUR 252

MFAP5 antibody

70R-18492 50 ul
EUR 435
Description: Rabbit polyclonal MFAP5 antibody

MFAP5 Antibody

DF13146 200ul
EUR 304
Description: MFAP5 Antibody detects endogenous levels of MFAP5.

MFAP5 Antibody

DF12539 200ul
EUR 304
Description: MFAP5 Antibody detects endogenous levels of MFAP5.

MFAP5 Antibody

1-CSB-PA013750GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MFAP5 Antibody

1-CSB-PA623799LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MFAP5 Antibody

1-CSB-PA701502
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

MFAP5 Polyclonal Antibody, HRP Conjugated

A56135 100 µg
EUR 570.55
Description: fast delivery possible

MFAP5 Polyclonal Antibody, FITC Conjugated

A56136 100 µg
EUR 570.55
Description: reagents widely cited

MFAP5 Polyclonal Antibody, Biotin Conjugated

A56137 100 µg
EUR 570.55
Description: Ask the seller for details

MFAP5 Conjugated Antibody

C37713 100ul
EUR 397

anti- MFAP5 antibody

FNab05147 100µg
EUR 548.75
  • Immunogen: microfibrillar associated protein 5
  • Uniprot ID: Q13361
  • Gene ID: 8076
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against MFAP5

Anti-MFAP5 antibody

PAab05147 100 ug
EUR 386

Anti-MFAP5 antibody

STJ192486 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MFAP5

MFAP5 siRNA

20-abx924031
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MFAP5 siRNA

20-abx924032
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MFAP5 Antibody, HRP conjugated

1-CSB-PA623799LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MFAP5 Antibody, FITC conjugated

1-CSB-PA623799LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MFAP5 Antibody, Biotin conjugated

1-CSB-PA623799LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse)

4-PAF590Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5)

MFAP5 Blocking Peptide

DF13146-BP 1mg
EUR 195

MFAP5 Blocking Peptide

DF12539-BP 1mg
EUR 195

MFAP5 cloning plasmid

CSB-CL623799HU-10ug 10ug
EUR 255
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 522
  • Sequence: atgtcgctcttgggacccaaggtgctgctgtttcttgctgcattcatcatcacctctgactggatacccctgggggtcaatagtcaacgaggagacgatgtgactcaagcgactccagaaacattcacagaagatcctaatctggtgaatgatcccgctacagatgaaacagtttt
  • Show more
Description: A cloning plasmid for the MFAP5 gene.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat)

4-PAF590Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5)

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), APC

4-PAF590Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), Biotinylated

4-PAF590Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), Cy3

4-PAF590Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), FITC

4-PAF590Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), HRP

4-PAF590Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), PE

4-PAF590Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat)

4-PAF590Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5)

Microfibrillar Associated Protein 5 (MFAP5) Antibody

20-abx113733
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

20-abx109326
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

abx122837-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

20-abx103845
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

20-abx103846
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

20-abx103847
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

abx235147-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

20-abx210999
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse MFAP5 shRNA Plasmid

20-abx974089
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MFAP5 ELISA Kit

ELA-E11955h 96 Tests
EUR 824

MFAP5 ELISA KIT|Human

EF004275 96 Tests
EUR 689

Human MFAP5 shRNA Plasmid

20-abx955358
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MFAP5 Recombinant Protein (Human)

RP019240 100 ug Ask for price

MFAP5 Recombinant Protein (Rat)

RP211505 100 ug Ask for price

MFAP5 Recombinant Protein (Mouse)

RP150392 100 ug Ask for price

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC

4-PAF590Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAF590Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Cy3

4-PAF590Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), FITC

4-PAF590Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), HRP

4-PAF590Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), PE

4-PAF590Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), APC-Cy7

4-PAF590Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC-Cy7.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC

4-PAF590Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAF590Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Cy3

4-PAF590Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), FITC

4-PAF590Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), HRP

4-PAF590Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), PE

4-PAF590Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAF590Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC-Cy7.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAF590Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC-Cy7.

Microfibrillar Associated Protein 5 (MFAP5) Antibody (HRP)

20-abx108500
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody (Biotin)

20-abx105662
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody (FITC)

20-abx107079
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody Pair

20-abx370581
  • EUR 1887.00
  • EUR 1191.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

MFAP5 ORF Vector (Human) (pORF)

ORF006414 1.0 ug DNA
EUR 95

Mfap5 ORF Vector (Mouse) (pORF)

ORF050132 1.0 ug DNA
EUR 506

Mfap5 ORF Vector (Rat) (pORF)

ORF070503 1.0 ug DNA
EUR 506

MFAP5 ELISA Kit (Mouse) (OKCA02409)

OKCA02409 96 Wells
EUR 846
Description: Description of target: May play a role in hematopoiesis. In the cardiovascular system, could regulate growth factors or participate in cell signaling in maintaining large vessel integrity . Component of the elastin-associated microfibrils.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.039 ng/mL

MFAP5 ELISA Kit (Rat) (OKCD08814)

OKCD08814 96 Wells
EUR 1053
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

MFAP5 ELISA Kit (Human) (OKEH02193)

OKEH02193 96 Wells
EUR 662
Description: Description of target: This gene encodes a 25-kD microfibril-associated glycoprotein which is a component of microfibrils of the extracellular matrix. The encoded protein promotes attachment of cells to microfibrils via alpha-V-beta-3 integrin. Deficiency of this gene in mice results in neutropenia. Alternate splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15 ng/mL

MFAP5 ELISA Kit (Mouse) (OKEH05621)

OKEH05621 96 Wells
EUR 779
Description: Description of target: May play a role in hematopoiesis. In the cardiovascular system, could regulate growth factors or participate in cell signaling in maintaining large vessel integrity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

MFAP5 ELISA Kit (Bovine) (OKEH07786)

OKEH07786 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

MFAP5 sgRNA CRISPR Lentivector set (Human)

K1295901 3 x 1.0 ug
EUR 339

Human Microfibrillar-associated protein 5 (MFAP5)

1-CSB-EP623799HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 33.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Microfibrillar-associated protein 5(MFAP5) expressed in E.coli

Mfap5 sgRNA CRISPR Lentivector set (Mouse)

K3664101 3 x 1.0 ug
EUR 339

Mfap5 sgRNA CRISPR Lentivector set (Rat)

K6495801 3 x 1.0 ug
EUR 339

Recombinant Microfibrillar Associated Protein 5 (MFAP5)

4-RPF590Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13361
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Microfibrillar Associated Protein 5 expressed in: E.coli

Recombinant Microfibrillar Associated Protein 5 (MFAP5)

4-RPF590Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QZJ6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.4kDa
  • Isoelectric Point: 6.8
Description: Recombinant Mouse Microfibrillar Associated Protein 5 expressed in: E.coli

Recombinant Microfibrillar Associated Protein 5 (MFAP5)

4-RPF590Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZJB1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.1kDa
  • Isoelectric Point: 6.3
Description: Recombinant Rat Microfibrillar Associated Protein 5 expressed in: E.coli

Human Microfibrillar Associated Protein 5 (MFAP5) Protein

20-abx068006
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Microfibrillar Associated Protein 5 (MFAP5) Protein

20-abx068008
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Microfibrillar Associated Protein 5 (MFAP5) Protein

20-abx068009
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MFAP5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1295902 1.0 ug DNA
EUR 154

MFAP5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1295903 1.0 ug DNA
EUR 154

MFAP5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1295904 1.0 ug DNA
EUR 154

Mfap5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3664102 1.0 ug DNA
EUR 154

Mfap5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3664103 1.0 ug DNA
EUR 154

Mfap5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3664104 1.0 ug DNA
EUR 154

Mfap5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6495802 1.0 ug DNA
EUR 154

Mfap5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6495803 1.0 ug DNA
EUR 154

Mfap5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6495804 1.0 ug DNA
EUR 154

MFAP5 Protein Vector (Rat) (pPB-C-His)

PV282010 500 ng
EUR 603

MFAP5 Protein Vector (Rat) (pPB-N-His)

PV282011 500 ng
EUR 603

MFAP5 Protein Vector (Rat) (pPM-C-HA)

PV282012 500 ng
EUR 603

MFAP5 Protein Vector (Rat) (pPM-C-His)

PV282013 500 ng
EUR 603

MFAP5 Protein Vector (Human) (pPB-C-His)

PV025653 500 ng
EUR 329

MFAP5 Protein Vector (Human) (pPB-N-His)

PV025654 500 ng
EUR 329

MFAP5 Protein Vector (Human) (pPM-C-HA)

PV025655 500 ng
EUR 329

MFAP5 Protein Vector (Human) (pPM-C-His)

PV025656 500 ng
EUR 329

MFAP5 Protein Vector (Mouse) (pPB-C-His)

PV200526 500 ng
EUR 603

MFAP5 Protein Vector (Mouse) (pPB-N-His)

PV200527 500 ng
EUR 603

MFAP5 Protein Vector (Mouse) (pPM-C-HA)

PV200528 500 ng
EUR 603

MFAP5 Protein Vector (Mouse) (pPM-C-His)

PV200529 500 ng
EUR 603

Mfap5 3'UTR GFP Stable Cell Line

TU163140 1.0 ml Ask for price

Mfap5 3'UTR Luciferase Stable Cell Line

TU213106 1.0 ml Ask for price

MFAP5 3'UTR Luciferase Stable Cell Line

TU013290 1.0 ml
EUR 1521

Mfap5 3'UTR Luciferase Stable Cell Line

TU113140 1.0 ml Ask for price

MFAP5 3'UTR GFP Stable Cell Line

TU063290 1.0 ml
EUR 1521

Mfap5 3'UTR GFP Stable Cell Line

TU263106 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

MFAP5 Rabbit Polyclonal Antibody