DDC Rabbit Polyclonal Antibody
DDC Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
DDC Polyclonal Antibody |
ES11130-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DDC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DDC Polyclonal Antibody |
ABP58339-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human DDC protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DDC from Human, Mouse, Rat. This DDC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDC protein |
DDC Polyclonal Antibody |
ABP58339-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DDC protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DDC from Human, Mouse, Rat. This DDC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDC protein |
DDC Polyclonal Antibody |
ABP58339-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DDC protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DDC from Human, Mouse, Rat. This DDC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDC protein |
Human Dopa Decarboxylase (DDC) ELISA Kit |
DLR-DDC-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Dopa Decarboxylase (DDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
DLR-DDC-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Dopa Decarboxylase (DDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
RDR-DDC-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dopa Decarboxylase (DDC) ELISA Kit |
RDR-DDC-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dopa Decarboxylase (DDC) ELISA Kit |
RD-DDC-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dopa Decarboxylase (DDC) ELISA Kit |
RD-DDC-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
DDC Rabbit pAb |
A3828-100ul |
Abclonal |
100 ul |
EUR 308 |
DDC Rabbit pAb |
A3828-200ul |
Abclonal |
200 ul |
EUR 459 |
DDC Rabbit pAb |
A3828-20ul |
Abclonal |
20 ul |
EUR 183 |
DDC Rabbit pAb |
A3828-50ul |
Abclonal |
50 ul |
EUR 223 |
Rabbit DDC ELISA Kit |
ERTD0239 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal DDC Antibody (N-term) |
APR07526G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC (N-term). This antibody is tested and proven to work in the following applications: |
DDC antibody |
70R-3369 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DDC antibody |
DDC Antibody |
43464-100ul |
SAB |
100ul |
EUR 252 |
DDC Antibody |
43658-100ul |
SAB |
100ul |
EUR 252 |
DDC antibody |
70R-1296 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal DDC antibody |
DDC antibody |
70R-14962 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Rabbit polyclonal DDC antibody |
DDC antibody |
70R-16773 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DDC antibody |
DDC Antibody |
1-CSB-PA006583GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DDC. Recognizes DDC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
DDC Antibody |
1-CSB-PA006583LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal DDC antibody - N-terminal region |
APR07527G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC - N-terminal region. This antibody is tested and proven to work in the following applications: |
DDC Conjugated Antibody |
C43464 |
SAB |
100ul |
EUR 397 |
DDC Conjugated Antibody |
C43658 |
SAB |
100ul |
EUR 397 |
DDC antibody (Bovine) |
70R-14960 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Rabbit polyclonal DDC antibody (Bovine) |
DDC antibody (Bovine) |
70R-14961 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Sheep polyclonal DDC antibody (Bovine) |
Anti-DDC antibody |
STJ23355 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. |
Anti-DDC antibody |
STJ192288 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DDC |
Polyclonal DDC / DOPA Decarboxylase Antibody (C-Terminus) |
APR07513G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC / DOPA Decarboxylase (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal DDC / DOPA Decarboxylase Antibody (N-Terminus) |
APR07524G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC / DOPA Decarboxylase (N-Terminus). This antibody is tested and proven to work in the following applications: |
Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine) |
4-PAG474Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC) |
Rabbit Dopamine Decarboxylase (DDC) ELISA Kit |
abx363630-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
DDC siRNA |
20-abx901446 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DDC siRNA |
20-abx913737 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DDC siRNA |
20-abx913738 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dopamine Decarboxylase (DDC) Antibody |
20-abx112157 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dopa Decarboxylase (DDC) Antibody |
20-abx128444 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dopamine Decarboxylase (DDC) Antibody |
20-abx002777 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dopa Decarboxylase (DDC) Antibody |
20-abx172148 |
Abbexa |
|
|
|
DOPA Decarboxylase (DDC) Antibody |
abx432618-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Dopamine Decarboxylase (DDC) Antibody |
abx411983-01ml |
Abbexa |
0.1 ml |
EUR 704 |
|
DOPA Decarboxylase (DDC) Antibody |
abx232510-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
DDC Antibody, HRP conjugated |
1-CSB-PA006583LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DDC Antibody, FITC conjugated |
1-CSB-PA006583LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DDC Antibody, Biotin conjugated |
1-CSB-PA006583LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), APC |
4-PAG474Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with APC. |
Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), Biotinylated |
4-PAG474Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with Biotin. |
Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), Cy3 |
4-PAG474Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with Cy3. |
Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), FITC |
4-PAG474Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with FITC. |
Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), HRP |
4-PAG474Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with HRP. |
Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), PE |
4-PAG474Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with PE. |
DDC cloning plasmid |
CSB-CL006583HU-10ug |
Cusabio |
10ug |
EUR 514 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1443
- Sequence: atgaacgcaagtgaattccgaaggagagggaaggagatggtggattacgtggccaactacatggaaggcattgagggacgccaggtctaccctgacgtggagcccgggtacctgcggccgctgatccctgccgctgcccctcaggagccagacacgtttgaggacatcatcaacg
- Show more
|
Description: A cloning plasmid for the DDC gene. |
DDC Blocking Peptide |
33R-2411 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDC antibody, catalog no. 70R-1296 |
DDC Blocking Peptide |
33R-8603 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDC antibody, catalog no. 70R-3369 |
Anti-DDC (8E8) |
YF-MA20317 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DDC |
Human DOPA Decarboxylase (DDC) Antibody |
32682-05111 |
AssayPro |
150 ug |
EUR 261 |
Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), APC-Cy7 |
4-PAG474Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with APC-Cy7. |
Rabbit Anti-Human Dopamine Decarboxylase (DDC) antiserum # 2 |
DDC12-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Rat DDC shRNA Plasmid |
20-abx984433 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DDC ELISA Kit |
EHD0239 |
Abclonal |
96Tests |
EUR 521 |
Goat DDC ELISA Kit |
EGTD0239 |
Abclonal |
96Tests |
EUR 521 |
Canine DDC ELISA Kit |
ECD0239 |
Abclonal |
96Tests |
EUR 521 |
Bovine DDC ELISA Kit |
EBD0239 |
Abclonal |
96Tests |
EUR 521 |
Anserini DDC ELISA Kit |
EAD0239 |
Abclonal |
96Tests |
EUR 521 |
Porcine DDC ELISA Kit |
EPD0239 |
Abclonal |
96Tests |
EUR 521 |
Rat DDC ELISA Kit |
ERD0239 |
Abclonal |
96Tests |
EUR 521 |
Mouse DDC ELISA Kit |
EMD0239 |
Abclonal |
96Tests |
EUR 521 |
Human DDC shRNA Plasmid |
20-abx951158 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse DDC shRNA Plasmid |
20-abx969967 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Dopa Decarboxylase (DDC) |
4-RPG474Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20711
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Dopa Decarboxylase expressed in: E.coli |
DDC Recombinant Protein (Human) |
RP054303 |
ABM |
100 ug |
Ask for price |
DDC Recombinant Protein (Rat) |
RP197543 |
ABM |
100 ug |
Ask for price |
DDC Recombinant Protein (Mouse) |
RP128270 |
ABM |
100 ug |
Ask for price |
DDC Recombinant Protein (Mouse) |
RP128273 |
ABM |
100 ug |
Ask for price |
Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit |
E04A1091-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit |
E04A1091-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit |
E04A1091-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody |
20-abx302246 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human DOPA Decarboxylase (DDC) Antibody (Biotin Conjugate) |
32682-05121 |
AssayPro |
150 ug |
EUR 369 |
Rabbit Anti-Human Dopamine Decarboxylase (DDC) IgG # 2, aff pure |
DDC12-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Guinea Pig DDC ELISA Kit |
EGD0239 |
Abclonal |
96Tests |
EUR 521 |
Human Dopa Decarboxylase (DDC) Protein |
20-abx166730 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Ddc ORF Vector (Rat) (pORF) |
ORF065849 |
ABM |
1.0 ug DNA |
EUR 506 |
h DDC inducible lentiviral particles |
LVP891 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing human target: DDC (dopa decarboxylase), [alternative names: AADC]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000790.3Â . It also contains a RFP-Blasticidin dual selection marker. |
Ddc ORF Vector (Mouse) (pORF) |
ORF042758 |
ABM |
1.0 ug DNA |
EUR 506 |
Ddc ORF Vector (Mouse) (pORF) |
ORF042759 |
ABM |
1.0 ug DNA |
EUR 506 |
DDC ORF Vector (Human) (pORF) |
ORF018102 |
ABM |
1.0 ug DNA |
EUR 405 |
DDC ELISA Kit (Human) (OKCD02490) |
OKCD02490 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL |
DDC ELISA Kit (Mouse) (OKEH05497) |
OKEH05497 |
Aviva Systems Biology |
96 Wells |
EUR 766 |
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL |
DDC ELISA Kit (Rat) (OKEH06172) |
OKEH06172 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (HRP) |
20-abx315663 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (FITC) |
20-abx315664 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (Biotin) |
20-abx315665 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human DOPA Decarboxylase (DDC) AssayLite Antibody (FITC Conjugate) |
32682-05141 |
AssayPro |
150 ug |
EUR 428 |
Human DOPA Decarboxylase (DDC) AssayLite Antibody (RPE Conjugate) |
32682-05151 |
AssayPro |
150 ug |
EUR 428 |
Human DOPA Decarboxylase (DDC) AssayLite Antibody (APC Conjugate) |
32682-05161 |
AssayPro |
150 ug |
EUR 428 |
Human DOPA Decarboxylase (DDC) AssayLite Antibody (PerCP Conjugate) |
32682-05171 |
AssayPro |
150 ug |
EUR 471 |
Cow Dopa Decarboxylase (DDC) ELISA Kit |
abx516891-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Dopa Decarboxylase (DDC) ELISA Kit |
abx516892-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Dopa Decarboxylase (DDC) ELISA Kit |
abx516893-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Dopa Decarboxylase (DDC) ELISA Kit |
abx516894-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Dopa Decarboxylase (DDC) ELISA Kit |
abx516895-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Dopamine Decarboxylase (DDC) ELISA Kit |
abx360760-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Dopa Decarboxylase (DDC) ELISA Kit |
20-abx571107 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human dopamine decarboxylase(DDC)ELISA Kit |
GA-E0902HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human dopamine decarboxylase(DDC)ELISA Kit |
GA-E0902HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Mouse dopamine decarboxylase(DDC)ELISA Kit |
GA-E0986MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse dopamine decarboxylase(DDC)ELISA Kit |
GA-E0986MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Rat dopamine decarboxylase(DDC)ELISA Kit |
GA-E0811RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat dopamine decarboxylase(DDC)ELISA Kit |
GA-E0811RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
DDC sgRNA CRISPR Lentivector set (Human) |
K0569001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Dopamine Decarboxylase (DDC) CLIA Kit |
abx196611-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Dopamine Decarboxylase (DDC) ELISA Kit |
abx358953-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Dopamine Decarboxylase (DDC) ELISA Kit |
abx355778-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Dopa Decarboxylase (DDC) CLIA Kit |
20-abx495210 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Dopamine Decarboxylase (DDC) ELISA Kit |
abx252328-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human dopamine decarboxylase,DDC ELISA Kit |
201-12-0886 |
SunredBio |
96 tests |
EUR 440 |
- This dopamine decarboxylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Ddc sgRNA CRISPR Lentivector set (Mouse) |
K3768401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Dopamine Decarboxylase (DDC) control peptide |
DDC11-P |
Alpha Diagnostics |
100 ug |
EUR 164 |
Human dopamine decarboxylase,DDC ELISA Kit |
CN-04501H1 |
ChemNorm |
96T |
EUR 447 |
Human dopamine decarboxylase,DDC ELISA Kit |
CN-04501H2 |
ChemNorm |
48T |
EUR 296 |
Ddc sgRNA CRISPR Lentivector set (Rat) |
K6903801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Dopa Decarboxylase (DDC) ELISA Kit |
SEG474Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
SEG474Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
SEG474Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
SEG474Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
4-SEG474Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dopa Decarboxylase elisa. Alternative names of the recognized antigen: AADC
- Aromatic L-Amino Acid Decarboxylase
- DOPA decarboxylase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human DDC (Dopa Decarboxylase) |
ELK3653 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dopa Decarboxylase (DDC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dopa Deca
- Show more
|
Description: A sandwich ELISA kit for detection of Dopa Decarboxylase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
DDC sgRNA CRISPR Lentivector (Human) (Target 1) |
K0569002 |
ABM |
1.0 ug DNA |
EUR 154 |
DDC sgRNA CRISPR Lentivector (Human) (Target 2) |
K0569003 |
ABM |
1.0 ug DNA |
EUR 154 |
DDC sgRNA CRISPR Lentivector (Human) (Target 3) |
K0569004 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddc sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3768402 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddc sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3768403 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddc sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3768404 |
ABM |
1.0 ug DNA |
EUR 154 |
CLIA kit for Human DDC (Dopamine Decarboxylase) |
E-CL-H0798 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's DDC CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DDC . Standards or samples are added to the micro CLIA plate wells and combined with the sp
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human DDC (Dopamine Decarboxylase) in samples from Serum, Plasma, Cell supernatant |
Human Dopamine Decarboxylase (DDC) control peptide # 2 |
DDC12-P |
Alpha Diagnostics |
100 ug |
EUR 164 |
ELISA kit for Human DDC (Dopamine Decarboxylase) |
E-EL-H1230 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's DDC ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DDC. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human DDC (Dopamine Decarboxylase) in samples from Serum, Plasma, Cell supernatant |
Ddc sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6903802 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddc sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6903803 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddc sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6903804 |
ABM |
1.0 ug DNA |
EUR 154 |
DDC Protein Vector (Human) (pPB-C-His) |
PV072405 |
ABM |
500 ng |
EUR 552 |
DDC Protein Vector (Human) (pPB-N-His) |
PV072406 |
ABM |
500 ng |
EUR 552 |
DDC Protein Vector (Human) (pPM-C-HA) |
PV072407 |
ABM |
500 ng |
EUR 552 |
DDC Protein Vector (Human) (pPM-C-His) |
PV072408 |
ABM |
500 ng |
EUR 552 |
DDC Protein Vector (Mouse) (pPB-C-His) |
PV171030 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPB-N-His) |
PV171031 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPM-C-HA) |
PV171032 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPM-C-His) |
PV171033 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPB-C-His) |
PV171034 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPB-N-His) |
PV171035 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPM-C-HA) |
PV171036 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPM-C-His) |
PV171037 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Rat) (pPB-C-His) |
PV263394 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Rat) (pPB-N-His) |
PV263395 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Rat) (pPM-C-HA) |
PV263396 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Rat) (pPM-C-His) |
PV263397 |
ABM |
500 ng |
EUR 603 |
Ddc 3'UTR Luciferase Stable Cell Line |
TU203228 |
ABM |
1.0 ml |
Ask for price |
Ddc 3'UTR GFP Stable Cell Line |
TU154934 |
ABM |
1.0 ml |
Ask for price |
DDC 3'UTR Luciferase Stable Cell Line |
TU005656 |
ABM |
1.0 ml |
EUR 1394 |
Ddc 3'UTR Luciferase Stable Cell Line |
TU104934 |
ABM |
1.0 ml |
Ask for price |
DDC 3'UTR GFP Stable Cell Line |
TU055656 |
ABM |
1.0 ml |
EUR 1394 |
Ddc 3'UTR GFP Stable Cell Line |
TU253228 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
DDC Rabbit Polyclonal Antibody