TIA1 Rabbit Polyclonal Antibody

TIA1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

TIA1 Polyclonal Antibody

ABP60680-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of TIA1 from Human, Mouse. This TIA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250

TIA1 Polyclonal Antibody

ABP60680-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of TIA1 from Human, Mouse. This TIA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250

TIA1 Polyclonal Antibody

ABP60680-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of TIA1 from Human, Mouse. This TIA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250

TIA1 Rabbit pAb

A12517-100ul 100 ul
EUR 308

TIA1 Rabbit pAb

A12517-200ul 200 ul
EUR 459

TIA1 Rabbit pAb

A12517-20ul 20 ul
EUR 183

TIA1 Rabbit pAb

A12517-50ul 50 ul
EUR 223

TIA1 Rabbit pAb

A12523-100ul 100 ul
EUR 308

TIA1 Rabbit pAb

A12523-200ul 200 ul
EUR 459

TIA1 Rabbit pAb

A12523-20ul 20 ul
EUR 183

TIA1 Rabbit pAb

A12523-50ul 50 ul
EUR 223

TIA1 Rabbit pAb

A6237-100ul 100 ul
EUR 308

TIA1 Rabbit pAb

A6237-200ul 200 ul
EUR 459

TIA1 Rabbit pAb

A6237-20ul 20 ul
EUR 183

TIA1 Rabbit pAb

A6237-50ul 50 ul
EUR 223

Anti-TIA1 Rabbit Monoclonal Antibody

M02763-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal TIA1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

TIA1 antibody

70R-5035 50 ug
EUR 467
Description: Rabbit polyclonal TIA1 antibody raised against the N terminal of TIA1

TIA1 antibody

70R-5036 50 ug
EUR 467
Description: Rabbit polyclonal TIA1 antibody raised against the C terminal of TIA1

TIA1 antibody

70R-20819 50 ul
EUR 435
Description: Rabbit polyclonal TIA1 antibody

TIA1 antibody

38767-100ul 100ul
EUR 252

TIA1 Antibody

49472-100ul 100ul
EUR 333

TIA1 Antibody

49472-50ul 50ul
EUR 239

TIA1 Antibody

43541-100ul 100ul
EUR 252

TIA1 Antibody

DF12176 200ul
EUR 304
Description: TIA1 antibody detects endogenous levels of TIA1.

TIA1 Antibody

1-CSB-PA023527DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TIA1. Recognizes TIA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

TIA1 Antibody

1-CSB-PA023527GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TIA1. Recognizes TIA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal Goat Anti-TIA1 Antibody

APG00331G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TIA1 . This antibody is tested and proven to work in the following applications:

TIA1 Conjugated Antibody

C38767 100ul
EUR 397

TIA1 Conjugated Antibody

C43541 100ul
EUR 397

TIA1 Conjugated Antibody

C49472 100ul
EUR 397

anti- TIA1 antibody

FNab08685 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:20 - 1:100
  • Immunogen: TIA1 cytotoxic granule-associated RNA binding protein
  • Uniprot ID: P31483
  • Gene ID: 7072
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against TIA1

Anti-TIA1 antibody

PAab08685 100 ug
EUR 386

Anti-TIA1 Antibody

PA2194 100ug/vial
EUR 294

Anti-TIA1 Antibody

STJ503251 100 µg
EUR 476

Anti-TIA1 Antibody

STJ503252 100 µg
EUR 476

Anti-TIA1 antibody

STJ71153 100 µg
EUR 359

Anti-TIA1 antibody

STJ27993 100 µl
EUR 277
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature.

Anti-TIA1 antibody

STJ114391 100 µl
EUR 277
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature.

Anti-TIA1 antibody

STJ114397 100 µl
EUR 277
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature.

Anti-TIA1 antibody

STJ192549 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TIA1

Anti-TIA1 Antibody Clone TIA1/1313, Unconjugated-20ug

7072-MSM1-P0 20ug
EUR 233

Anti-TIA1 Antibody Clone TIA1/1313, Unconjugated-100ug

7072-MSM1-P1 100ug
EUR 428

TIA1 siRNA

20-abx936750
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TIA1 siRNA

20-abx936751
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- TIA1

PVT10099 2 ug
EUR 266

anti-TIA1

YF-PA15031 50 ul
EUR 363
Description: Mouse polyclonal to TIA1

anti-TIA1

YF-PA15032 50 ug
EUR 363
Description: Mouse polyclonal to TIA1

anti-TIA1

YF-PA15033 100 ul
EUR 403
Description: Rabbit polyclonal to TIA1

Rabbit Anti-TIA1 monoclonal antibody, clone KN53-22

CABT-L930 100 ul
EUR 777

TIA1 recombinant monoclonal antibody

A5775 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human TIA1 for WB, IHC,ELISA

Anti-TIA1 Antibody (Biotin)

STJ503253 100 µg
EUR 586

Anti-TIA1 Antibody (FITC)

STJ503254 100 µg
EUR 586

Anti-TIA1 Antibody (Biotin)

STJ503255 100 µg
EUR 586

Anti-TIA1 Antibody (FITC)

STJ503256 100 µg
EUR 586

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC551313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF555 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC551313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF555 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC611313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF660R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC611313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF660R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC401313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF640R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC401313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF640R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC431313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF543 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC431313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF543 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC471313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF647 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC471313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF647 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC051313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405M conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC051313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405M conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC041313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405S conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC041313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405S conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNUB1313-100 100uL
EUR 209
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), Concentration: 0.2mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNUB1313-500 500uL
EUR 458
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), Concentration: 0.2mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNUM1313-50 50uL
EUR 395
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), 1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC681313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF568 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC681313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF568 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC701313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF770 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC701313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF770 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC881313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF488A conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC881313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF488A conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC941313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF594 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC941313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF594 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCB1313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Biotin conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCB1313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Biotin conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCH1313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCH1313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC801313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC801313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCP1313-250 250uL
EUR 383
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),PerCP conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCR1313-250 250uL
EUR 383
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),RPE conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCA1313-250 250uL
EUR 383
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),APC conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCAP1313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCAP1313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC811313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC811313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680R conjugate, Concentration: 0.1mg/mL

TIA1 cloning plasmid

CSB-CL023527HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atggaggacgagatgcccaagactctatacgtcggtaacctttccagagatgtgacagaagctctaattctgcaactctttagccagattggaccttgtaaaaactgcaaaatgattatggatacagctggaaatgatccctattgttttgtggagtttcatgagcatcgtcatgc
  • Show more
Description: A cloning plasmid for the TIA1 gene.

TIA1 Blocking Peptide

33R-6040 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIA1 antibody, catalog no. 70R-5035

TIA1 Blocking Peptide

33R-7484 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIA1 antibody, catalog no. 70R-5036

TIA1 Blocking Peptide

DF12176-BP 1mg
EUR 195

pCMV-SPORT6-TIA1

PVT13169 2 ug
EUR 391

TIA1 ELISA KIT|Human

EF003599 96 Tests
EUR 689

Human TIA1 shRNA Plasmid

20-abx954841
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TIA1 shRNA Plasmid

20-abx973110
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TIA1 Recombinant Protein (Human)

RP031537 100 ug Ask for price

TIA1 Recombinant Protein (Rat)

RP233102 100 ug Ask for price

TIA1 Recombinant Protein (Mouse)

RP178679 100 ug Ask for price

TIA1 Recombinant Protein (Mouse)

RP178682 100 ug Ask for price

TIA1 Recombinant Protein (Mouse)

RP178685 100 ug Ask for price

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

20-abx116099
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

abx122851-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

20-abx142262
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

20-abx004762
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

20-abx321381
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

abx431671-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

abx238685-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tia1 ORF Vector (Mouse) (pORF)

ORF059561 1.0 ug DNA
EUR 506

Tia1 ORF Vector (Mouse) (pORF)

ORF059562 1.0 ug DNA
EUR 506

Tia1 ORF Vector (Mouse) (pORF)

ORF059563 1.0 ug DNA
EUR 506

TIA1 ORF Vector (Human) (pORF)

ORF010513 1.0 ug DNA
EUR 95

Tia1 ORF Vector (Rat) (pORF)

ORF077702 1.0 ug DNA
EUR 506

Mouse Anti-Human TIA1 monoclonal antibody, clone JID786

CABT-L2816-100uL500uL 100 uL, 500 uL
EUR 502

TIA1 sgRNA CRISPR Lentivector set (Human)

K2372501 3 x 1.0 ug
EUR 339

Tia1 sgRNA CRISPR Lentivector set (Mouse)

K4931401 3 x 1.0 ug
EUR 339

Tia1 sgRNA CRISPR Lentivector set (Rat)

K6339901 3 x 1.0 ug
EUR 339

Mouse Nucleolysin TIA- 1, Tia1 ELISA KIT

ELI-52046m 96 Tests
EUR 865

TIA1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2372502 1.0 ug DNA
EUR 154

TIA1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2372503 1.0 ug DNA
EUR 154

TIA1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2372504 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4931402 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4931403 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4931404 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6339902 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6339903 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6339904 1.0 ug DNA
EUR 154

TIA1 Protein Vector (Human) (pPB-C-His)

PV042049 500 ng
EUR 329

TIA1 Protein Vector (Human) (pPB-N-His)

PV042050 500 ng
EUR 329

TIA1 Protein Vector (Human) (pPM-C-HA)

PV042051 500 ng
EUR 329

TIA1 Protein Vector (Human) (pPM-C-His)

PV042052 500 ng
EUR 329

TIA1 Protein Vector (Rat) (pPB-C-His)

PV310806 500 ng
EUR 603

TIA1 Protein Vector (Rat) (pPB-N-His)

PV310807 500 ng
EUR 603

TIA1 Protein Vector (Rat) (pPM-C-HA)

PV310808 500 ng
EUR 603

TIA1 Protein Vector (Rat) (pPM-C-His)

PV310809 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPB-C-His)

PV238242 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPB-N-His)

PV238243 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPM-C-HA)

PV238244 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPM-C-His)

PV238245 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPB-C-His)

PV238246 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPB-N-His)

PV238247 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPM-C-HA)

PV238248 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPM-C-His)

PV238249 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPB-C-His)

PV238250 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPB-N-His)

PV238251 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPM-C-HA)

PV238252 500 ng
EUR 603

TIA1 Protein Vector (Mouse) (pPM-C-His)

PV238253 500 ng
EUR 603

Tia1 3'UTR GFP Stable Cell Line

TU170480 1.0 ml Ask for price

TIA1 3'UTR GFP Stable Cell Line

TU075566 1.0 ml
EUR 2333

Tia1 3'UTR Luciferase Stable Cell Line

TU120480 1.0 ml Ask for price

TIA1 3'UTR Luciferase Stable Cell Line

TU025566 1.0 ml
EUR 2333

Tia1 3'UTR Luciferase Stable Cell Line

TU221880 1.0 ml Ask for price

Tia1 3'UTR GFP Stable Cell Line

TU271880 1.0 ml Ask for price

Anti-TIA1 (T-Cell-Restricted Intracellular Antigen-1) Monoclonal Antibody

M02763 100ug/vial
EUR 397
Description: Mouse Monoclonal TIA1 (T-Cell-Restricted Intracellular Antigen-1) Antibody. Validated in WB and tested in Human.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

TIA1 Rabbit Polyclonal Antibody