TIA1 Rabbit Polyclonal Antibody
TIA1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
TIA1 Polyclonal Antibody |
ABP60680-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250
- Applications tips:
|
Description: A polyclonal antibody for detection of TIA1 from Human, Mouse. This TIA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250 |
TIA1 Polyclonal Antibody |
ABP60680-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250
- Applications tips:
|
Description: A polyclonal antibody for detection of TIA1 from Human, Mouse. This TIA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250 |
TIA1 Polyclonal Antibody |
ABP60680-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250
- Applications tips:
|
Description: A polyclonal antibody for detection of TIA1 from Human, Mouse. This TIA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250 |
TIA1 Rabbit pAb |
A12517-100ul |
Abclonal |
100 ul |
EUR 308 |
TIA1 Rabbit pAb |
A12517-200ul |
Abclonal |
200 ul |
EUR 459 |
TIA1 Rabbit pAb |
A12517-20ul |
Abclonal |
20 ul |
EUR 183 |
TIA1 Rabbit pAb |
A12517-50ul |
Abclonal |
50 ul |
EUR 223 |
TIA1 Rabbit pAb |
A12523-100ul |
Abclonal |
100 ul |
EUR 308 |
TIA1 Rabbit pAb |
A12523-200ul |
Abclonal |
200 ul |
EUR 459 |
TIA1 Rabbit pAb |
A12523-20ul |
Abclonal |
20 ul |
EUR 183 |
TIA1 Rabbit pAb |
A12523-50ul |
Abclonal |
50 ul |
EUR 223 |
TIA1 Rabbit pAb |
A6237-100ul |
Abclonal |
100 ul |
EUR 308 |
TIA1 Rabbit pAb |
A6237-200ul |
Abclonal |
200 ul |
EUR 459 |
TIA1 Rabbit pAb |
A6237-20ul |
Abclonal |
20 ul |
EUR 183 |
TIA1 Rabbit pAb |
A6237-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-TIA1 Rabbit Monoclonal Antibody |
M02763-1 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal TIA1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse. |
TIA1 antibody |
70R-5035 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TIA1 antibody raised against the N terminal of TIA1 |
TIA1 antibody |
70R-5036 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TIA1 antibody raised against the C terminal of TIA1 |
TIA1 antibody |
70R-20819 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TIA1 antibody |
TIA1 antibody |
38767-100ul |
SAB |
100ul |
EUR 252 |
TIA1 Antibody |
49472-100ul |
SAB |
100ul |
EUR 333 |
TIA1 Antibody |
49472-50ul |
SAB |
50ul |
EUR 239 |
TIA1 Antibody |
43541-100ul |
SAB |
100ul |
EUR 252 |
TIA1 Antibody |
DF12176 |
Affbiotech |
200ul |
EUR 304 |
Description: TIA1 antibody detects endogenous levels of TIA1. |
TIA1 Antibody |
1-CSB-PA023527DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TIA1. Recognizes TIA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000 |
TIA1 Antibody |
1-CSB-PA023527GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TIA1. Recognizes TIA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal Goat Anti-TIA1 Antibody |
APG00331G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TIA1 . This antibody is tested and proven to work in the following applications: |
TIA1 Conjugated Antibody |
C38767 |
SAB |
100ul |
EUR 397 |
TIA1 Conjugated Antibody |
C43541 |
SAB |
100ul |
EUR 397 |
TIA1 Conjugated Antibody |
C49472 |
SAB |
100ul |
EUR 397 |
anti- TIA1 antibody |
FNab08685 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- IF: 1:20 - 1:100
- Immunogen: TIA1 cytotoxic granule-associated RNA binding protein
- Uniprot ID: P31483
- Gene ID: 7072
- Research Area: Cancer, Immunology, Metabolism
|
Description: Antibody raised against TIA1 |
Anti-TIA1 Antibody |
PA2194 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-TIA1 antibody |
STJ27993 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. |
Anti-TIA1 antibody |
STJ114391 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. |
Anti-TIA1 antibody |
STJ114397 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. |
Anti-TIA1 antibody |
STJ192549 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TIA1 |
Anti-TIA1 Antibody Clone TIA1/1313, Unconjugated-20ug |
7072-MSM1-P0 |
EnQuireBio |
20ug |
EUR 233 |
Anti-TIA1 Antibody Clone TIA1/1313, Unconjugated-100ug |
7072-MSM1-P1 |
EnQuireBio |
100ug |
EUR 428 |
TIA1 siRNA |
20-abx936750 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TIA1 siRNA |
20-abx936751 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TIA1 |
YF-PA15031 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to TIA1 |
anti-TIA1 |
YF-PA15032 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TIA1 |
anti-TIA1 |
YF-PA15033 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to TIA1 |
TIA1 recombinant monoclonal antibody |
A5775 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human TIA1 for WB, IHC,ELISA |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC551313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF555 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC551313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF555 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC611313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF660R conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC611313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF660R conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC401313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF640R conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC401313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF640R conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC431313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF543 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC431313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF543 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC471313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF647 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC471313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF647 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC051313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405M conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC051313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405M conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC041313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405S conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC041313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405S conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNUB1313-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), Concentration: 0.2mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNUB1313-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), Concentration: 0.2mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNUM1313-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), 1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC681313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF568 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC681313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF568 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC701313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF770 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC701313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF770 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC881313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF488A conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC881313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF488A conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC941313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF594 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC941313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF594 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCB1313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Biotin conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCB1313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Biotin conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCH1313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCH1313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC801313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC801313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680 conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCP1313-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),PerCP conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCR1313-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),RPE conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCA1313-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),APC conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCAP1313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNCAP1313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC811313-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680R conjugate, Concentration: 0.1mg/mL |
TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody |
BNC811313-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680R conjugate, Concentration: 0.1mg/mL |
TIA1 cloning plasmid |
CSB-CL023527HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 645
- Sequence: atggaggacgagatgcccaagactctatacgtcggtaacctttccagagatgtgacagaagctctaattctgcaactctttagccagattggaccttgtaaaaactgcaaaatgattatggatacagctggaaatgatccctattgttttgtggagtttcatgagcatcgtcatgc
- Show more
|
Description: A cloning plasmid for the TIA1 gene. |
TIA1 Blocking Peptide |
33R-6040 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIA1 antibody, catalog no. 70R-5035 |
TIA1 Blocking Peptide |
33R-7484 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIA1 antibody, catalog no. 70R-5036 |
TIA1 Blocking Peptide |
DF12176-BP |
Affbiotech |
1mg |
EUR 195 |
Human TIA1 shRNA Plasmid |
20-abx954841 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TIA1 shRNA Plasmid |
20-abx973110 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TIA1 Recombinant Protein (Human) |
RP031537 |
ABM |
100 ug |
Ask for price |
TIA1 Recombinant Protein (Rat) |
RP233102 |
ABM |
100 ug |
Ask for price |
TIA1 Recombinant Protein (Mouse) |
RP178679 |
ABM |
100 ug |
Ask for price |
TIA1 Recombinant Protein (Mouse) |
RP178682 |
ABM |
100 ug |
Ask for price |
TIA1 Recombinant Protein (Mouse) |
RP178685 |
ABM |
100 ug |
Ask for price |
Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody |
20-abx116099 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody |
abx122851-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody |
20-abx142262 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody |
20-abx004762 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody |
20-abx321381 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody |
abx431671-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody |
abx238685-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Tia1 ORF Vector (Mouse) (pORF) |
ORF059561 |
ABM |
1.0 ug DNA |
EUR 506 |
Tia1 ORF Vector (Mouse) (pORF) |
ORF059562 |
ABM |
1.0 ug DNA |
EUR 506 |
Tia1 ORF Vector (Mouse) (pORF) |
ORF059563 |
ABM |
1.0 ug DNA |
EUR 506 |
TIA1 ORF Vector (Human) (pORF) |
ORF010513 |
ABM |
1.0 ug DNA |
EUR 95 |
Tia1 ORF Vector (Rat) (pORF) |
ORF077702 |
ABM |
1.0 ug DNA |
EUR 506 |
Mouse Anti-Human TIA1 monoclonal antibody, clone JID786 |
CABT-L2816-100uL500uL |
Creative Diagnostics |
100 uL, 500 uL |
EUR 502 |
TIA1 sgRNA CRISPR Lentivector set (Human) |
K2372501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tia1 sgRNA CRISPR Lentivector set (Mouse) |
K4931401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tia1 sgRNA CRISPR Lentivector set (Rat) |
K6339901 |
ABM |
3 x 1.0 ug |
EUR 339 |
TIA1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2372502 |
ABM |
1.0 ug DNA |
EUR 154 |
TIA1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2372503 |
ABM |
1.0 ug DNA |
EUR 154 |
TIA1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2372504 |
ABM |
1.0 ug DNA |
EUR 154 |
Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4931402 |
ABM |
1.0 ug DNA |
EUR 154 |
Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4931403 |
ABM |
1.0 ug DNA |
EUR 154 |
Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4931404 |
ABM |
1.0 ug DNA |
EUR 154 |
Tia1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6339902 |
ABM |
1.0 ug DNA |
EUR 154 |
Tia1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6339903 |
ABM |
1.0 ug DNA |
EUR 154 |
Tia1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6339904 |
ABM |
1.0 ug DNA |
EUR 154 |
TIA1 Protein Vector (Human) (pPB-C-His) |
PV042049 |
ABM |
500 ng |
EUR 329 |
TIA1 Protein Vector (Human) (pPB-N-His) |
PV042050 |
ABM |
500 ng |
EUR 329 |
TIA1 Protein Vector (Human) (pPM-C-HA) |
PV042051 |
ABM |
500 ng |
EUR 329 |
TIA1 Protein Vector (Human) (pPM-C-His) |
PV042052 |
ABM |
500 ng |
EUR 329 |
TIA1 Protein Vector (Rat) (pPB-C-His) |
PV310806 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Rat) (pPB-N-His) |
PV310807 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Rat) (pPM-C-HA) |
PV310808 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Rat) (pPM-C-His) |
PV310809 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPB-C-His) |
PV238242 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPB-N-His) |
PV238243 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPM-C-HA) |
PV238244 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPM-C-His) |
PV238245 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPB-C-His) |
PV238246 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPB-N-His) |
PV238247 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPM-C-HA) |
PV238248 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPM-C-His) |
PV238249 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPB-C-His) |
PV238250 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPB-N-His) |
PV238251 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPM-C-HA) |
PV238252 |
ABM |
500 ng |
EUR 603 |
TIA1 Protein Vector (Mouse) (pPM-C-His) |
PV238253 |
ABM |
500 ng |
EUR 603 |
Tia1 3'UTR GFP Stable Cell Line |
TU170480 |
ABM |
1.0 ml |
Ask for price |
TIA1 3'UTR GFP Stable Cell Line |
TU075566 |
ABM |
1.0 ml |
EUR 2333 |
Tia1 3'UTR Luciferase Stable Cell Line |
TU120480 |
ABM |
1.0 ml |
Ask for price |
TIA1 3'UTR Luciferase Stable Cell Line |
TU025566 |
ABM |
1.0 ml |
EUR 2333 |
Tia1 3'UTR Luciferase Stable Cell Line |
TU221880 |
ABM |
1.0 ml |
Ask for price |
Tia1 3'UTR GFP Stable Cell Line |
TU271880 |
ABM |
1.0 ml |
Ask for price |
Anti-TIA1 (T-Cell-Restricted Intracellular Antigen-1) Monoclonal Antibody |
M02763 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Mouse Monoclonal TIA1 (T-Cell-Restricted Intracellular Antigen-1) Antibody. Validated in WB and tested in Human. |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
TIA1 Rabbit Polyclonal Antibody