LAX1 Rabbit Polyclonal Antibody
LAX1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
LAX1 Polyclonal Antibody |
27649-50ul |
SAB |
50ul |
EUR 187 |
LAX1 Polyclonal Antibody |
ABP59097-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110 |
LAX1 Polyclonal Antibody |
ABP59097-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110 |
LAX1 Polyclonal Antibody |
ABP59097-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110 |
LAX1 Polyclonal Antibody |
ES11285-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LAX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LAX1 Polyclonal Antibody |
ES11285-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LAX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LAX1 Rabbit pAb |
A12218-100ul |
Abclonal |
100 ul |
EUR 308 |
LAX1 Rabbit pAb |
A12218-200ul |
Abclonal |
200 ul |
EUR 459 |
LAX1 Rabbit pAb |
A12218-20ul |
Abclonal |
20 ul |
EUR 183 |
LAX1 Rabbit pAb |
A12218-50ul |
Abclonal |
50 ul |
EUR 223 |
LAX1 Polyclonal Conjugated Antibody |
C27649 |
SAB |
100ul |
EUR 397 |
LAX1 antibody |
70R-18223 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LAX1 antibody |
LAX1 Antibody |
1-CSB-PA811614LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
LAX1 antibody |
70R-6590 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal LAX1 antibody raised against the middle region of LAX1 |
LAX1 antibody |
70R-9683 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal LAX1 antibody |
LAX1 Antibody |
1-CSB-PA012771GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal LAX1 Antibody (internal region) |
APR17176G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LAX1 (internal region). This antibody is tested and proven to work in the following applications: |
anti- LAX1 antibody |
FNab04710 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: lymphocyte transmembrane adaptor 1
- Uniprot ID: Q8IWV1
- Gene ID: 54900
- Research Area: Signal Transduction
|
Description: Antibody raised against LAX1 |
Anti-LAX1 antibody |
STJ192443 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LAX1 |
LAX1 siRNA |
20-abx902939 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LAX1 siRNA |
20-abx922300 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LAX1 siRNA |
20-abx922301 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-LAX1 |
YF-PA19440 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to LAX1 |
LAX1 Antibody, HRP conjugated |
1-CSB-PA811614LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LAX1 Antibody, FITC conjugated |
1-CSB-PA811614LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LAX1 Antibody, Biotin conjugated |
1-CSB-PA811614LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LAX1 Blocking Peptide |
33R-4955 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LAX1 antibody, catalog no. 70R-6590 |
LAX1 Blocking Peptide |
33R-1089 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCTD11 antibody, catalog no. 70R-1493 |
LAX1 cloning plasmid |
CSB-CL811614HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 969
- Sequence: atgcccttgctgactttgccacaaaccagacaaagagccaaaaatatttatgacatcttgccttggcgacaggaagacctggggagacatgagtcgaggagtatgcgcattttcagtactgagagcctcctctccagaaattctgagagcccggagcatgtgccctcccaagcagg
- Show more
|
Description: A cloning plasmid for the LAX1 gene. |
Rat LAX1 shRNA Plasmid |
20-abx990851 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LAX1 shRNA Plasmid |
20-abx960308 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse LAX1 shRNA Plasmid |
20-abx982472 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LAX1 Recombinant Protein (Human) |
RP017578 |
ABM |
100 ug |
Ask for price |
LAX1 Recombinant Protein (Rat) |
RP207857 |
ABM |
100 ug |
Ask for price |
LAX1 Recombinant Protein (Mouse) |
RP146936 |
ABM |
100 ug |
Ask for price |
LAX1 Recombinant Protein (Mouse) |
RP146939 |
ABM |
100 ug |
Ask for price |
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
20-abx113547 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
20-abx126081 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
abx030461-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
abx030461-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
20-abx318746 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
abx234710-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
abx432919-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (HRP) |
20-abx316368 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (FITC) |
20-abx316369 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (Biotin) |
20-abx316370 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lax1 ORF Vector (Rat) (pORF) |
ORF069287 |
ABM |
1.0 ug DNA |
EUR 506 |
LAX1 ORF Vector (Human) (pORF) |
ORF005860 |
ABM |
1.0 ug DNA |
EUR 95 |
Lax1 ORF Vector (Mouse) (pORF) |
ORF048980 |
ABM |
1.0 ug DNA |
EUR 506 |
Lax1 ORF Vector (Mouse) (pORF) |
ORF048981 |
ABM |
1.0 ug DNA |
EUR 506 |
Lax1 sgRNA CRISPR Lentivector set (Rat) |
K7491701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lax1 sgRNA CRISPR Lentivector set (Mouse) |
K3218401 |
ABM |
3 x 1.0 ug |
EUR 339 |
LAX1 sgRNA CRISPR Lentivector set (Human) |
K1198401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7491702 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7491703 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7491704 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3218402 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3218403 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3218404 |
ABM |
1.0 ug DNA |
EUR 154 |
LAX1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1198402 |
ABM |
1.0 ug DNA |
EUR 154 |
LAX1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1198403 |
ABM |
1.0 ug DNA |
EUR 154 |
LAX1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1198404 |
ABM |
1.0 ug DNA |
EUR 154 |
LAX1 Protein Vector (Human) (pPB-C-His) |
PV023437 |
ABM |
500 ng |
EUR 329 |
LAX1 Protein Vector (Human) (pPB-N-His) |
PV023438 |
ABM |
500 ng |
EUR 329 |
LAX1 Protein Vector (Human) (pPM-C-HA) |
PV023439 |
ABM |
500 ng |
EUR 329 |
LAX1 Protein Vector (Human) (pPM-C-His) |
PV023440 |
ABM |
500 ng |
EUR 329 |
LAX1 Protein Vector (Rat) (pPB-C-His) |
PV277146 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Rat) (pPB-N-His) |
PV277147 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Rat) (pPM-C-HA) |
PV277148 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Rat) (pPM-C-His) |
PV277149 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPB-C-His) |
PV195918 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPB-N-His) |
PV195919 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPM-C-HA) |
PV195920 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPM-C-His) |
PV195921 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPB-C-His) |
PV195922 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPB-N-His) |
PV195923 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPM-C-HA) |
PV195924 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPM-C-His) |
PV195925 |
ABM |
500 ng |
EUR 603 |
Lax1 3'UTR Luciferase Stable Cell Line |
TU110921 |
ABM |
1.0 ml |
Ask for price |
Lax1 3'UTR GFP Stable Cell Line |
TU160921 |
ABM |
1.0 ml |
Ask for price |
Lax1 3'UTR Luciferase Stable Cell Line |
TU206959 |
ABM |
1.0 ml |
Ask for price |
Lax1 3'UTR GFP Stable Cell Line |
TU256959 |
ABM |
1.0 ml |
Ask for price |
LAX1 3'UTR GFP Stable Cell Line |
TU062289 |
ABM |
1.0 ml |
EUR 1521 |
LAX1 3'UTR Luciferase Stable Cell Line |
TU012289 |
ABM |
1.0 ml |
EUR 1521 |
Human Lymphocyte transmembrane adapter 1, LAX1 ELISA KIT |
ELI-19284h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Lymphocyte transmembrane adapter 1, LAX1 ELISA KIT |
ELI-21100b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Lymphocyte transmembrane adapter 1 (LAX1) ELISA Kit |
abx388235-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Lymphocyte transmembrane adapter 1, Lax1 ELISA KIT |
ELI-37755m |
Lifescience Market |
96 Tests |
EUR 865 |
LAX1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV679417 |
ABM |
1.0 ug DNA |
EUR 682 |
LAX1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV679421 |
ABM |
1.0 ug DNA |
EUR 682 |
LAX1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV679422 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
LAX1 Rabbit Polyclonal Antibody